Morpholino

MO1-ildr1b

ID
ZDB-MRPHLNO-150323-8
Name
MO1-ildr1b
Previous Names
None
Target
Sequence
5' - GTATTTTAATGTCAGCTTACCTTCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ildr1b
Expressed Gene Anatomy Figures
ackr3b Fig. 8 from Sang et al., 2014
axin2 Fig. 8 from Sang et al., 2014
cxcr4b Fig. 8 from Sang et al., 2014
etv4 Fig. 8 from Sang et al., 2014
fgf3 Fig. 8 from Sang et al., 2014
fgf10a Fig. 8 from Sang et al., 2014
fgfr1a Fig. 8 from Sang et al., 2014
il17rd Fig. 8 from Sang et al., 2014
lef1 Fig. 8 from Sang et al., 2014
Phenotype
Phenotype resulting from MO1-ildr1b
Phenotype Fish Figures
auditory behavior decreased process quality, abnormal AB + MO1-ildr1b Fig. 3 from Sang et al., 2014
posterior lateral line neuromast decreased amount, abnormal AB + MO1-ildr1b Fig. 5,  Fig. 6,  Fig. S6 from Sang et al., 2014
posterior lateral line neuromast deposition decreased process quality, abnormal zf551Tg + MO1-ildr1b Fig. 6 from Sang et al., 2014
posterior lateral line primordium disorganized, abnormal zf551Tg + MO1-ildr1b Fig. 6 from Sang et al., 2014
posterior lateral line primordium structure, abnormal zf551Tg + MO1-ildr1b Fig. 6 from Sang et al., 2014
semicircular canal malformed, abnormal AB + MO1-ildr1b Fig. 4 from Sang et al., 2014
semicircular canal development delayed, abnormal AB + MO1-ildr1b Fig. 4 from Sang et al., 2014
startle response decreased process quality, abnormal AB + MO1-ildr1b Fig. 3 from Sang et al., 2014
Phenotype of all Fish created by or utilizing MO1-ildr1b
Phenotype Fish Conditions Figures
semicircular canal development delayed, abnormal AB + MO1-ildr1b control Fig. 4 from Sang et al., 2014
startle response decreased process quality, abnormal AB + MO1-ildr1b control Fig. 3 from Sang et al., 2014
semicircular canal malformed, abnormal AB + MO1-ildr1b control Fig. 4 from Sang et al., 2014
posterior lateral line neuromast decreased amount, abnormal AB + MO1-ildr1b control Fig. 5,  Fig. S6 from Sang et al., 2014
auditory behavior decreased process quality, abnormal AB + MO1-ildr1b control Fig. 3 from Sang et al., 2014
posterior lateral line neuromast decreased amount, abnormal AB + MO1-ildr1b + MO4-tp53 control Fig. S6 from Sang et al., 2014
posterior lateral line primordium disorganized, abnormal zf551Tg + MO1-ildr1b control Fig. 6 from Sang et al., 2014
posterior lateral line primordium structure, abnormal zf551Tg + MO1-ildr1b control Fig. 6 from Sang et al., 2014
posterior lateral line neuromast decreased amount, abnormal zf551Tg + MO1-ildr1b control Fig. 6 from Sang et al., 2014
posterior lateral line neuromast deposition decreased process quality, abnormal zf551Tg + MO1-ildr1b control Fig. 6 from Sang et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.