Morpholino

MO4-bag3

ID

ZDB-MRPHLNO-150212-2

Name

MO4-bag3

Previous Names

None

Target

Sequence

5' - GATAAATAACACACATACCTGAGGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-bag3

No data available

Phenotype

Phenotype resulting from MO4-bag3

Phenotype	Fish	Figures
skeletal muscle cell broken, abnormal	WT + MO4-bag3	Fig. 6, Fig. 7 from Ruparelia et al., 2014
skeletal muscle cell mitochondrion accumulation skeletal muscle cell, abnormal	WT + MO4-bag3	Fig. 7 from Ruparelia et al., 2014
skeletal muscle cell skeletal muscle myofibril broken, abnormal	WT + MO4-bag3	Fig. 7 from Ruparelia et al., 2014
skeletal muscle cell skeletal muscle myofibril disorganized, abnormal	WT + MO4-bag3	Fig. 7 from Ruparelia et al., 2014
skeletal muscle cell Z disc disorganized, abnormal	WT + MO4-bag3	Fig. 7 from Ruparelia et al., 2014
skeletal muscle cell Z disc morphology, abnormal	WT + MO4-bag3	Fig. 7 from Ruparelia et al., 2014
slow muscle cell broken, abnormal	WT + MO4-bag3	Fig. 7 from Ruparelia et al., 2014
slow muscle cell autophagosome increased amount, abnormal	WT + MO4-bag3	Fig. 7 from Ruparelia et al., 2014

Phenotype of all Fish created by or utilizing MO4-bag3

Phenotype	Fish	Conditions	Figures
skeletal muscle cell broken, abnormal	WT + MO3-bag3 + MO4-bag3	standard conditions	Fig. 8 from Ruparelia et al., 2014
skeletal muscle cell Z disc disorganized, abnormal	WT + MO4-bag3	standard conditions	Fig. 7 from Ruparelia et al., 2014
skeletal muscle cell skeletal muscle myofibril broken, abnormal	WT + MO4-bag3	standard conditions	Fig. 7 from Ruparelia et al., 2014
skeletal muscle cell skeletal muscle myofibril disorganized, abnormal	WT + MO4-bag3	standard conditions	Fig. 7 from Ruparelia et al., 2014
skeletal muscle cell broken, abnormal	WT + MO4-bag3	standard conditions	Fig. 6, Fig. 7 from Ruparelia et al., 2014
skeletal muscle cell broken, abnormal	WT + MO4-bag3	chemical treatment: methyl cellulose	Fig. 6 from Ruparelia et al., 2014
skeletal muscle cell mitochondrion accumulation skeletal muscle cell, abnormal	WT + MO4-bag3	standard conditions	Fig. 7 from Ruparelia et al., 2014
skeletal muscle cell Z disc morphology, abnormal	WT + MO4-bag3	standard conditions	Fig. 7 from Ruparelia et al., 2014
slow muscle cell broken, abnormal	WT + MO4-bag3	standard conditions	Fig. 7 from Ruparelia et al., 2014
slow muscle cell autophagosome increased amount, abnormal	WT + MO4-bag3	standard conditions	Fig. 7 from Ruparelia et al., 2014

Citations