Morpholino
MO7-notch1b
- ID
- ZDB-MRPHLNO-150209-2
- Name
- MO7-notch1b
- Previous Names
- None
- Target
- Sequence
-
5' - GTCGAGAATCTTATCACTTACTTGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO7-notch1b
Expressed Gene | Anatomy | Figures |
---|---|---|
dlc |
Fig. S4
from Kim et al., 2014 |
|
efnb2a |
Fig. S4
from Kim et al., 2014 |
|
foxc1b |
Fig. S4
from Kim et al., 2014 |
|
gata2a |
Fig. 7 ![]() |
|
gata2b |
Fig. 7 ![]() |
|
kdrl |
Fig. S4
from Kim et al., 2014 |
|
myod1 |
Fig. S4
from Kim et al., 2014 |
|
runx1 |
Fig. 7 ![]() Fig. S4 from Kim et al., 2014 |
|
twist1b |
Fig. S4
from Kim et al., 2014 |
Phenotype
Phenotype resulting from MO7-notch1b
Phenotype | Fish | Figures |
---|---|---|
hematopoietic progenitor cell differentiation process quality, abnormal | AB + MO7-notch1b |
Fig. S4
from Kim et al., 2014 |
Phenotype of all Fish created by or utilizing MO7-notch1b
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
hematopoietic progenitor cell differentiation process quality, abnormal | AB + MO7-notch1b | standard conditions |
Fig. S4
from Kim et al., 2014 |
Citations