Morpholino
MO1-npr2
- ID
- ZDB-MRPHLNO-150206-2
- Name
- MO1-npr2
- Previous Names
- None
- Target
- Sequence
-
5' - AACCAAGAACACTCAACTCACCCCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO. When verifying the sequence of this MO, I was not able to get a good match in ZFIN. I was, however, able to get a 100% match to the npr2 sequence available in Ensembl.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-npr2
No data available
Phenotype
Phenotype resulting from MO1-npr2
No data available
Phenotype of all Fish created by or utilizing MO1-npr2
from 1 - 2 of 2
Citations
- Chiba, A., Watanabe-Takano, H., Terai, K., Fukui, H., Miyazaki, T., Uemura, M., Hashimoto, H., Hibi, M., Fukuhara, S., Mochizuki, N. (2017) Osteocrin, a peptide secreted from the heart and other tissues, contributes to cranial osteogenesis and chondrogenesis in zebrafish. Development (Cambridge, England). 144(2):334-344
- Becker, J.R., Chatterjee, S., Robinson, T.Y., Bennett, J.S., Panáková, D., Galindo, C.L., Zhong, L., Shin, J.T., Coy, S.M., Kelly, A.E., Roden, D.M., Lim, C.C., and MacRae, C.A. (2014) Differential activation of natriuretic peptide receptors modulates cardiomyocyte proliferation during development. Development (Cambridge, England). 141(2):335-345
1 - 2 of 2
Show