Morpholino

MO1-cdc42

ID
ZDB-MRPHLNO-150120-1
Name
MO1-cdc42
Previous Names
None
Target
Sequence
5' - CAACGACGCACTTGATCGTCTGCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdc42
No data available
Phenotype
Phenotype resulting from MO1-cdc42
Phenotype Fish Figures
brain hydrocephalic, abnormal WT + MO1-cdc42 Fig. 1Fig. 2 from Choi et al., 2013
caudal fin curved, abnormal WT + MO1-cdc42 Fig. 1 from Choi et al., 2013
caudal fin decreased length, abnormal WT + MO1-cdc42 Fig. 1 from Choi et al., 2013
eye decreased size, abnormal WT + MO1-cdc42 Fig. 1 from Choi et al., 2015
Fig. 1Fig. 2 from Choi et al., 2013
melanosome transport delayed, abnormal WT + MO1-cdc42 Fig. 6 from Choi et al., 2015
pericardium edematous, abnormal WT + MO1-cdc42 Fig. 1 from Choi et al., 2013
photoreceptor cell photoreceptor inner segment absent, abnormal WT + MO1-cdc42 Fig. 4 from Choi et al., 2015
photoreceptor cell photoreceptor outer segment absent, abnormal WT + MO1-cdc42 Fig. 4 from Choi et al., 2015
Fig. 2 from Choi et al., 2013
photoreceptor cell photoreceptor outer segment decreased amount, abnormal WT + MO1-cdc42 Fig. 4 from Choi et al., 2015
photoreceptor cell photoreceptor outer segment decreased length, abnormal WT + MO1-cdc42 Fig. 4 from Choi et al., 2015
photoreceptor cell photoreceptor outer segment morphology, abnormal WT + MO1-cdc42 Fig. 4 from Choi et al., 2015
pronephric duct cilium disorganized, abnormal WT + MO1-cdc42 Fig. 2 from Choi et al., 2013
renal glomerulus disorganized, abnormal WT + MO1-cdc42 Fig. 2 from Choi et al., 2013
renal glomerulus distended, abnormal WT + MO1-cdc42 Fig. 2 from Choi et al., 2013
renal tubule dilated, abnormal WT + MO1-cdc42 Fig. 2 from Choi et al., 2013
retina apoptotic, abnormal WT + MO1-cdc42 Fig. 3 from Choi et al., 2015
retina decreased size, abnormal WT + MO1-cdc42 Fig. 2 from Choi et al., 2015
retina apoptotic process increased occurrence, abnormal WT + MO1-cdc42 Fig. 3 from Choi et al., 2015
retina cell decreased amount, abnormal WT + MO1-cdc42 Fig. 2 from Choi et al., 2015
retinal ganglion cell layer apoptotic, abnormal WT + MO1-cdc42 Fig. 3 from Choi et al., 2015
retinal inner nuclear layer apoptotic, abnormal WT + MO1-cdc42 Fig. 3 from Choi et al., 2015
retinal outer nuclear layer decreased thickness, abnormal WT + MO1-cdc42 Fig. 2 from Choi et al., 2015
Phenotype of all Fish created by or utilizing MO1-cdc42
Phenotype Fish Conditions Figures
retinal ganglion cell layer apoptotic, abnormal WT + MO1-cdc42 standard conditions Fig. 3 from Choi et al., 2015
photoreceptor cell photoreceptor outer segment decreased length, abnormal WT + MO1-cdc42 standard conditions Fig. 4 from Choi et al., 2015
photoreceptor cell photoreceptor outer segment absent, abnormal WT + MO1-cdc42 standard conditions Fig. 4 from Choi et al., 2015
Fig. 2 from Choi et al., 2013
pronephric duct cilium disorganized, abnormal WT + MO1-cdc42 standard conditions Fig. 2 from Choi et al., 2013
renal glomerulus distended, abnormal WT + MO1-cdc42 standard conditions Fig. 2 from Choi et al., 2013
photoreceptor cell photoreceptor outer segment morphology, abnormal WT + MO1-cdc42 standard conditions Fig. 4 from Choi et al., 2015
pericardium edematous, abnormal WT + MO1-cdc42 standard conditions Fig. 1 from Choi et al., 2013
renal glomerulus disorganized, abnormal WT + MO1-cdc42 standard conditions Fig. 2 from Choi et al., 2013
photoreceptor cell photoreceptor inner segment absent, abnormal WT + MO1-cdc42 standard conditions Fig. 4 from Choi et al., 2015
retina cell decreased amount, abnormal WT + MO1-cdc42 standard conditions Fig. 2 from Choi et al., 2015
retina decreased size, abnormal WT + MO1-cdc42 standard conditions Fig. 2 from Choi et al., 2015
retina apoptotic, abnormal WT + MO1-cdc42 standard conditions Fig. 3 from Choi et al., 2015
caudal fin decreased length, abnormal WT + MO1-cdc42 standard conditions Fig. 1 from Choi et al., 2013
caudal fin curved, abnormal WT + MO1-cdc42 standard conditions Fig. 1 from Choi et al., 2013
melanosome transport delayed, abnormal WT + MO1-cdc42 standard conditions Fig. 6 from Choi et al., 2015
brain hydrocephalic, abnormal WT + MO1-cdc42 standard conditions Fig. 1Fig. 2 from Choi et al., 2013
retinal inner nuclear layer apoptotic, abnormal WT + MO1-cdc42 standard conditions Fig. 3 from Choi et al., 2015
photoreceptor cell photoreceptor outer segment decreased amount, abnormal WT + MO1-cdc42 standard conditions Fig. 4 from Choi et al., 2015
retina apoptotic process increased occurrence, abnormal WT + MO1-cdc42 standard conditions Fig. 3 from Choi et al., 2015
eye decreased size, abnormal WT + MO1-cdc42 standard conditions Fig. 1 from Choi et al., 2015
Fig. 1Fig. 2 from Choi et al., 2013
retinal outer nuclear layer decreased thickness, abnormal WT + MO1-cdc42 standard conditions Fig. 2 from Choi et al., 2015
renal tubule dilated, abnormal WT + MO1-cdc42 standard conditions Fig. 2 from Choi et al., 2013
gut edematous, abnormal WT + MO1-cdc42 + MO1-dnmbp standard conditions Fig. 6 from Baek et al., 2016
cilium assembly disrupted, abnormal WT + MO1-cdc42 + MO1-dnmbp standard conditions Fig. 6 from Baek et al., 2016
eye decreased size, abnormal WT + MO1-cdc42 + MO1-dnmbp standard conditions Fig. 6 from Baek et al., 2016
pronephric duct cilium disorganized, abnormal WT + MO1-cdc42 + MO1-dnmbp standard conditions Fig. 6 from Baek et al., 2016
post-vent region curved ventral, abnormal WT + MO1-cdc42 + MO1-dnmbp standard conditions Fig. 6 from Baek et al., 2016
caudal fin curved, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 3 from Choi et al., 2013
photoreceptor cell photoreceptor outer segment morphology, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 5 from Choi et al., 2015
eye decreased size, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 5 from Choi et al., 2015
Fig. 3 from Choi et al., 2013
pericardium edematous, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 3 from Choi et al., 2013
retinal outer nuclear layer absent, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 5 from Choi et al., 2015
retina apoptotic, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions text only from Choi et al., 2015
caudal fin decreased length, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 3 from Choi et al., 2013
brain hydrocephalic, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 3 from Choi et al., 2013
photoreceptor cell photoreceptor outer segment decreased amount, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 5 from Choi et al., 2015
melanosome transport delayed, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 6 from Choi et al., 2015
Citations