header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-150108-1
Morpholino Name: MO3-grk5
Target: grk5 (1)
Sequence:
5' - TATACAAACCATCATACCATTTCTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO. This morpholino contains a single nucleotide mismatch from the sequence in Ensembl. 5' -TATACAAAC"C"ATCATACCATTTCTT- 3'
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-grk5 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-grk5 No data available
PHENOTYPE
Phenotype resulting from MO3-grk5
Phenotype of all Fish created by or utilizing MO3-grk5
OTHER MO3-grk5 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)