ZFIN ID: ZDB-MRPHLNO-141107-1
Morpholino Name: MO5-wt1a
Target: wt1a (1)
Previous Name: MO 3-4 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGCTGCTGGGATTGAAAACAACAAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-wt1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-wt1a
Expressed Gene Anatomy Figures
nphs1 Fig. 4 with image from Schnerwitzki et al., 2014
PHENOTYPE
Phenotype resulting from MO5-wt1a
Phenotype of all Fish created by or utilizing MO5-wt1a
Genome Resources:
CITATIONS (1)