Morpholino

MO2-sox11a

ID
ZDB-MRPHLNO-141007-5
Name
MO2-sox11a
Previous Names
None
Target
Sequence
5' - GTGCGTTGTCAGTCCAAAATATCAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sox11a
No data available
Phenotype
Phenotype resulting from MO2-sox11a
No data available
Phenotype of all Fish created by or utilizing MO2-sox11a
Phenotype Fish Conditions Figures
optic fissure closure incomplete, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 9 with image from Wen et al., 2015
Fig. 2 with imageFig. 3 with imageFig. 7 with image from Pillai-Kastoori et al., 2014
retina has fewer parts of type retinal rod cell, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 3 with image from Pillai-Kastoori et al., 2014
optic vesicle cell population proliferation increased process quality, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. S2 with image from Pillai-Kastoori et al., 2014
retina layer formation decreased process quality, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 2 with image from Pillai-Kastoori et al., 2014
retina protruding out of brain, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 2 with image from Pillai-Kastoori et al., 2014
optic fissure open, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 2 with imageFig. 3 with imageFig. 7 with image from Pillai-Kastoori et al., 2014
retinal pigmented epithelium open, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 2 with image from Pillai-Kastoori et al., 2014
eye decreased size, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 2 with image from Pillai-Kastoori et al., 2014
retinal rod cell development process quality, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 3 with image from Pillai-Kastoori et al., 2014
lens apoptotic process increased process quality, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. S2 with image from Pillai-Kastoori et al., 2014
optic vesicle apoptotic process increased process quality, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. S2 with image from Pillai-Kastoori et al., 2014
retina cell population proliferation increased process quality, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. S2 with image from Pillai-Kastoori et al., 2014
lens malformed, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 9 with image from Wen et al., 2015
Fig. 2 with imageFig. 7 with image from Pillai-Kastoori et al., 2014
caudal fin kinked, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 2 with image from Pillai-Kastoori et al., 2014
retina ventral region decreased pigmentation, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 2 with imageFig. 7 with image from Pillai-Kastoori et al., 2014
retina ventral region immature, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 2 with image from Pillai-Kastoori et al., 2014
closure of optic fissure decreased process quality, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 9 with image from Wen et al., 2015
optic fissure closure incomplete, abnormal WT + MO1-sox11b + MO2-sox11a + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 9 with image from Wen et al., 2015
closure of optic fissure decreased process quality, abnormal WT + MO1-sox11b + MO2-sox11a + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 9 with image from Wen et al., 2015
lens malformed, abnormal WT + MO1-sox11b + MO2-sox11a + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 9 with image from Wen et al., 2015
Citations