ZFIN ID: ZDB-MRPHLNO-141003-2
Morpholino Name: MO2-clstn1
Target: clstn1 (1)
Sequence:
5' - GAGTTTTGGCAGTCACTTACCATCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-clstn1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-clstn1 No data available
PHENOTYPE
Phenotype resulting from MO2-clstn1
Phenotype of all Fish created by or utilizing MO2-clstn1
Phenotype Fish Conditions Figures
trigeminal ganglion collateral sprouting decreased occurrence, abnormal AB + MO2-clstn1 standard conditions Fig. 2 from Ponomareva et al., 2014
Rohon-Beard neuron filopodium decreased stability, abnormal AB + MO2-clstn1 control Fig. 5 with image from Lee et al., 2017
Rohon-Beard neuron axon decreased branchiness, abnormal AB + MO2-clstn1 standard conditions Fig. 2 from Ponomareva et al., 2014
Rohon-Beard neuron collateral sprouting decreased occurrence, abnormal AB + MO2-clstn1 standard conditions Fig. 2 from Ponomareva et al., 2014
Rohon-Beard neuron retrograde axonal transport increased occurrence, abnormal AB + MO2-clstn1 control Fig. 3 with image from Lee et al., 2017
trigeminal ganglion axon decreased branchiness, abnormal AB + MO2-clstn1 standard conditions Fig. 2 from Ponomareva et al., 2014
Rohon-Beard neuron filopodium collapsed, abnormal AB + MO2-clstn1 control Fig. 5 with image from Lee et al., 2017
Rohon-Beard neuron growth cone decreased volume, abnormal uw4Tg + MO2-clstn1 standard conditions Fig. 4 from Ponomareva et al., 2014
Rohon-Beard neuron anterograde axonal transport decreased occurrence, abnormal uw4Tg + MO2-clstn1 standard conditions Fig. 6Fig. 7 from Ponomareva et al., 2014
Rohon-Beard neuron axon decreased branchiness, abnormal uw4Tg + MO2-clstn1 standard conditions Fig. 4 from Ponomareva et al., 2014
Rohon-Beard neuron early endosome mislocalised, abnormal uw4Tg + MO2-clstn1 standard conditions Fig. 7 from Ponomareva et al., 2014
Rohon-Beard neuron retrograde transport, endosome to plasma membrane decreased occurrence, abnormal uw4Tg + MO2-clstn1 standard conditions Fig. 6Fig. 7 from Ponomareva et al., 2014
Rohon-Beard neuron collateral sprouting decreased occurrence, abnormal uw4Tg + MO2-clstn1 standard conditions Fig. 4 from Ponomareva et al., 2014
Rohon-Beard neuron growth cone decreased branchiness, abnormal uw4Tg + MO2-clstn1 standard conditions Fig. 4 from Ponomareva et al., 2014
Rohon-Beard neuron axon extension increased rate, abnormal uw4Tg + MO2-clstn1 standard conditions Fig. 4 from Ponomareva et al., 2014
Genome Resources:
CITATIONS (2)