Morpholino

MO1-esrrgb

ID
ZDB-MRPHLNO-141002-4
Name
MO1-esrrgb
Previous Names
  • T-ERR y-B (1)
Target
Sequence
5' - GGTGATAAAACTGCACTAGATCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-esrrgb
No data available
Phenotype
Phenotype resulting from MO1-esrrgb
Phenotype Fish Figures
caudal fin decreased length, abnormal WT + MO1-esrrgb Fig. 3 from Tohmé et al., 2014
eye malformed, abnormal WT + MO1-esrrgb Fig. 3 from Tohmé et al., 2014
forebrain shape, abnormal WT + MO1-esrrgb Fig. 3 from Tohmé et al., 2014
head decreased size, abnormal WT + MO1-esrrgb Fig. 3 from Tohmé et al., 2014
heart edematous, abnormal WT + MO1-esrrgb Fig. 3 from Tohmé et al., 2014
hindbrain decreased length, abnormal WT + MO1-esrrgb Fig. 3 from Tohmé et al., 2014
hindbrain swollen, abnormal WT + MO1-esrrgb Fig. 3 from Tohmé et al., 2014
otic vesicle circular, abnormal WT + MO1-esrrgb Fig. 3 from Tohmé et al., 2014
otolith absent, abnormal WT + MO1-esrrgb Fig. 3 from Tohmé et al., 2014
semicircular canal absent, abnormal WT + MO1-esrrgb Fig. 3 from Tohmé et al., 2014
ventral mandibular arch decreased size, abnormal WT + MO1-esrrgb Fig. 3 from Tohmé et al., 2014
whole organism decreased length, abnormal WT + MO1-esrrgb Fig. 3 from Tohmé et al., 2014
yolk posterior side decreased size, abnormal WT + MO1-esrrgb Fig. 3 from Tohmé et al., 2014
Phenotype of all Fish created by or utilizing MO1-esrrgb
Phenotype Fish Conditions Figures
eye malformed, abnormal WT + MO1-esrrgb standard conditions Fig. 3 from Tohmé et al., 2014
otolith absent, abnormal WT + MO1-esrrgb standard conditions Fig. 3 from Tohmé et al., 2014
hindbrain decreased length, abnormal WT + MO1-esrrgb standard conditions Fig. 3 from Tohmé et al., 2014
otic vesicle circular, abnormal WT + MO1-esrrgb standard conditions Fig. 3 from Tohmé et al., 2014
yolk posterior side decreased size, abnormal WT + MO1-esrrgb standard conditions Fig. 3 from Tohmé et al., 2014
head decreased size, abnormal WT + MO1-esrrgb standard conditions Fig. 3 from Tohmé et al., 2014
caudal fin decreased length, abnormal WT + MO1-esrrgb standard conditions Fig. 3 from Tohmé et al., 2014
ventral mandibular arch decreased size, abnormal WT + MO1-esrrgb standard conditions Fig. 3 from Tohmé et al., 2014
forebrain shape, abnormal WT + MO1-esrrgb standard conditions Fig. 3 from Tohmé et al., 2014
semicircular canal absent, abnormal WT + MO1-esrrgb standard conditions Fig. 3 from Tohmé et al., 2014
heart edematous, abnormal WT + MO1-esrrgb standard conditions Fig. 3 from Tohmé et al., 2014
hindbrain swollen, abnormal WT + MO1-esrrgb standard conditions Fig. 3 from Tohmé et al., 2014
whole organism decreased length, abnormal WT + MO1-esrrgb standard conditions Fig. 3 from Tohmé et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.