Morpholino

MO2-exosc8

ID
ZDB-MRPHLNO-140929-2
Name
MO2-exosc8
Previous Names
None
Target
Sequence
5' - TTTAAAACCAGCCGCCATGATGTTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-exosc8
No data available
Phenotype
Phenotype resulting from MO2-exosc8
Phenotype Fish Figures
axonogenesis disrupted, abnormal rw0Tg + MO2-exosc8 Fig. 5 with image from Giunta et al., 2016
brain development disrupted, abnormal rw0Tg + MO2-exosc8 text only from Boczonadi et al., 2014
cerebellar Purkinje cell layer structural organization disrupted, abnormal rw0Tg + MO2-exosc8 Fig. 5 with image from Giunta et al., 2016
cerebellum structure, abnormal rw0Tg + MO2-exosc8 Fig. 5 with image from Giunta et al., 2016
cerebellum Purkinje cell distributed, abnormal rw0Tg + MO2-exosc8 Fig. 5 with image from Giunta et al., 2016
eye decreased size, abnormal rw0Tg + MO2-exosc8 text only from Boczonadi et al., 2014
eye shape, abnormal rw0Tg + MO2-exosc8 text only from Boczonadi et al., 2014
hindbrain morphology, abnormal rw0Tg + MO2-exosc8 Fig. 4 with image from Giunta et al., 2016
hindbrain morphogenesis disrupted, abnormal rw0Tg + MO2-exosc8 Fig. 4 with image from Giunta et al., 2016
motor neuron axon branchiness, abnormal rw0Tg + MO2-exosc8 Fig. 5 with image from Giunta et al., 2016
motor neuron axon truncated, abnormal rw0Tg + MO2-exosc8 Fig. 5 with image from Giunta et al., 2016
pericardium edematous, abnormal rw0Tg + MO2-exosc8 text only from Boczonadi et al., 2014
post-vent region decreased length, abnormal rw0Tg + MO2-exosc8 text only from Boczonadi et al., 2014
sensory perception of touch disrupted, abnormal rw0Tg + MO2-exosc8 text only from Boczonadi et al., 2014
swimming disrupted, abnormal rw0Tg + MO2-exosc8 text only from Boczonadi et al., 2014
whole organism malformed, abnormal rw0Tg + MO2-exosc8 text only from Boczonadi et al., 2014
Phenotype of all Fish created by or utilizing MO2-exosc8
Phenotype Fish Conditions Figures
post-vent region decreased length, abnormal rw0Tg + MO2-exosc8 standard conditions text only from Boczonadi et al., 2014
cerebellar Purkinje cell layer structural organization disrupted, abnormal rw0Tg + MO2-exosc8 standard conditions Fig. 5 with image from Giunta et al., 2016
motor neuron axon truncated, abnormal rw0Tg + MO2-exosc8 standard conditions Fig. 5 with image from Giunta et al., 2016
eye shape, abnormal rw0Tg + MO2-exosc8 standard conditions text only from Boczonadi et al., 2014
whole organism malformed, abnormal rw0Tg + MO2-exosc8 standard conditions text only from Boczonadi et al., 2014
sensory perception of touch disrupted, abnormal rw0Tg + MO2-exosc8 standard conditions text only from Boczonadi et al., 2014
cerebellum Purkinje cell distributed, abnormal rw0Tg + MO2-exosc8 standard conditions Fig. 5 with image from Giunta et al., 2016
motor neuron axon branchiness, abnormal rw0Tg + MO2-exosc8 standard conditions Fig. 5 with image from Giunta et al., 2016
brain development disrupted, abnormal rw0Tg + MO2-exosc8 standard conditions text only from Boczonadi et al., 2014
cerebellum structure, abnormal rw0Tg + MO2-exosc8 standard conditions Fig. 5 with image from Giunta et al., 2016
pericardium edematous, abnormal rw0Tg + MO2-exosc8 standard conditions text only from Boczonadi et al., 2014
axonogenesis disrupted, abnormal rw0Tg + MO2-exosc8 standard conditions Fig. 5 with image from Giunta et al., 2016
hindbrain morphogenesis disrupted, abnormal rw0Tg + MO2-exosc8 standard conditions Fig. 4 with image from Giunta et al., 2016
swimming disrupted, abnormal rw0Tg + MO2-exosc8 standard conditions text only from Boczonadi et al., 2014
eye decreased size, abnormal rw0Tg + MO2-exosc8 standard conditions text only from Boczonadi et al., 2014
hindbrain morphology, abnormal rw0Tg + MO2-exosc8 standard conditions Fig. 4 with image from Giunta et al., 2016
whole organism atxn1b expression increased amount, abnormal slc24a5unspecified/unspecified + MO2-exosc8 standard conditions Fig. 6 from Giunta et al., 2016
Citations