Morpholino

MO5-slc16a2

ID
ZDB-MRPHLNO-140925-1
Name
MO5-slc16a2
Previous Names
  • MCT8MO (1)
Target
Sequence
5' - TCATCGCTTTCCGAGTGCATCCTAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-slc16a2
No data available
Phenotype
Phenotype resulting from MO5-slc16a2
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal AB + MO5-slc16a2 Fig. 3 from Campinho et al., 2014
basilar artery has extra parts of type basilar artery pericyte, abnormal y1Tg + MO5-slc16a2 Fig. 2 with image from Trindade et al., 2025
basilar artery has fewer parts of type basilar artery pericyte, abnormal y1Tg + MO5-slc16a2 Fig. 2 with image from Trindade et al., 2025
basilar artery vasculature development delayed, abnormal y1Tg + MO5-slc16a2 Fig. 2 with image from Trindade et al., 2025
brain pax6a expression decreased amount, abnormal AB + MO5-slc16a2 Fig. 3 with image from Silva et al., 2017
brain wls expression increased amount, abnormal AB + MO5-slc16a2 Fig. 2 with image from Silva et al., 2017
brain development disrupted, abnormal AB + MO5-slc16a2 Fig. 2Fig. 3Fig. 5 from Campinho et al., 2014
central artery lacks all parts of type central artery pericyte, abnormal y1Tg + MO5-slc16a2 Fig. 2 with image from Trindade et al., 2025
central artery sprouting angiogenesis decreased process quality, abnormal y1Tg + MO5-slc16a2 Fig. 6 with image from Trindade et al., 2025
central artery vasculature development delayed, abnormal y1Tg + MO5-slc16a2 Fig. 2 with image from Trindade et al., 2025
cerebellum vasculature development disrupted, abnormal y1Tg + MO5-slc16a2 Fig. 4 from Campinho et al., 2014
cranial nerve V neuron decreased amount, abnormal AB + MO5-slc16a2 Fig. 7 from Campinho et al., 2014
cranial vasculature morphology, abnormal AB + MO5-slc16a2 Fig. 4 with image from Silva et al., 2017
dorsal aorta flt4 expression increased amount, abnormal AB + MO5-slc16a2 Fig. 4 with image from Silva et al., 2017
embryonic camera-type eye development disrupted, abnormal AB + MO5-slc16a2 Fig. 6 from Campinho et al., 2014
forebrain neurod6b expression decreased amount, abnormal AB + MO5-slc16a2 Fig. 3 with image from Silva et al., 2017
hindbrain slc16a2 expression absent, abnormal y1Tg + MO5-slc16a2 Fig. 7 with image from Trindade et al., 2025
hindbrain her2 expression decreased amount, abnormal AB + MO5-slc16a2 Fig. 2 with image from Silva et al., 2017
hindbrain gad1b expression decreased amount, abnormal AB + MO5-slc16a2 Fig. 3 with image from Silva et al., 2017
hindbrain flt4 expression decreased amount, abnormal AB + MO5-slc16a2 Fig. 4 with image from Silva et al., 2017
hindbrain dla expression decreased amount, abnormal AB + MO5-slc16a2 Fig. 2 with image from Silva et al., 2017
hindbrain vegfaa expression decreased amount, abnormal y1Tg + MO5-slc16a2 Fig. 1 with image from Trindade et al., 2025
hindbrain pax6a expression decreased amount, abnormal AB + MO5-slc16a2 Fig. 3 with image from Silva et al., 2017
hindbrain wnt1 expression decreased amount, abnormal AB + MO5-slc16a2 Fig. 2 with image from Silva et al., 2017
hindbrain vegfaa expression decreased distribution, abnormal y1Tg + MO5-slc16a2 Fig. 1 with image from Trindade et al., 2025
hindbrain has fewer parts of type central artery, abnormal y1Tg + MO5-slc16a2 Fig. 1 with image from Trindade et al., 2025
hindbrain has fewer parts of type motor neuron, abnormal nkgSA2AzGFF306AGt; nkuasgfp1aTg; y171Tg + MO5-slc16a2 Fig. 4 with image from Trindade et al., 2025
hindbrain wls expression increased amount, abnormal AB + MO5-slc16a2 Fig. 2 with image from Silva et al., 2017
hindbrain brain vasculature lacks parts or has fewer parts of type central artery, abnormal y1Tg + MO5-slc16a2 Fig. 5 with imageFig. 9 with image from Trindade et al., 2025
hindbrain posterior region pax8 expression absent, abnormal y1Tg + MO5-slc16a2 Fig. 3 with image from Trindade et al., 2025
hindbrain posterior region pax8 expression decreased amount, abnormal y1Tg + MO5-slc16a2 Fig. 3 with image from Trindade et al., 2025
hindbrain posterior region pax8 expression decreased distribution, abnormal y1Tg + MO5-slc16a2 Fig. 3 with image from Trindade et al., 2025
hindbrain vasculature development decreased process quality, abnormal y1Tg + MO5-slc16a2 Fig. 1 with imageFig. 5 with imageFig. 9 with image from Trindade et al., 2025
hindbrain ventral region vegfaa expression decreased amount, abnormal y1Tg + MO5-slc16a2 Fig. 5 with image from Trindade et al., 2025
hindbrain ventral region pax6a expression decreased amount, abnormal y1Tg + MO5-slc16a2 Fig. 5 with image from Trindade et al., 2025
hindbrain ventral region vegfaa expression decreased distribution, abnormal y1Tg + MO5-slc16a2 Fig. 5 with image from Trindade et al., 2025
hindbrain ventral region pax6a expression decreased distribution, abnormal y1Tg + MO5-slc16a2 Fig. 5 with image from Trindade et al., 2025
hindbrain interneuron decreased amount, abnormal AB + MO5-slc16a2 Fig. 7 from Campinho et al., 2014
midbrain her2 expression decreased amount, abnormal AB + MO5-slc16a2 Fig. 2 with image from Silva et al., 2017
midbrain rorab expression decreased amount, abnormal AB + MO5-slc16a2 Fig. 3 with image from Silva et al., 2017
midbrain decreased size, abnormal AB + MO5-slc16a2 Fig. 5 from Campinho et al., 2014
optic cup rorab expression decreased amount, abnormal AB + MO5-slc16a2 Fig. 3 with image from Silva et al., 2017
posterior cardinal vein flt4 expression increased amount, abnormal AB + MO5-slc16a2 Fig. 4 with image from Silva et al., 2017
primordial hindbrain channel has fewer parts of type primordial hindbrain channel pericyte, abnormal y1Tg + MO5-slc16a2 Fig. 2 with image from Trindade et al., 2025
primordial hindbrain channel hypoplastic, abnormal AB + MO5-slc16a2 Fig. 4 with image from Silva et al., 2017
primordial hindbrain channel vasculature development delayed, abnormal y1Tg + MO5-slc16a2 Fig. 2 with image from Trindade et al., 2025
spinal cord her2 expression decreased amount, abnormal AB + MO5-slc16a2 Fig. 2 with image from Silva et al., 2017
spinal cord dla expression decreased amount, abnormal AB + MO5-slc16a2 Fig. 2 with image from Silva et al., 2017
spinal cord pax6a expression decreased amount, abnormal AB + MO5-slc16a2 Fig. 3 with image from Silva et al., 2017
spinal cord wls expression increased amount, abnormal AB + MO5-slc16a2 Fig. 2 with image from Silva et al., 2017
spinal cord gad1b expression spatial pattern, abnormal AB + MO5-slc16a2 Fig. 3 with image from Silva et al., 2017
spinal cord neuron decreased amount, abnormal AB + MO5-slc16a2 Fig. 5 from Campinho et al., 2014
spinal cord development disrupted, abnormal AB + MO5-slc16a2 Fig. 5 from Campinho et al., 2014
spinal cord interneuron decreased amount, abnormal AB + MO5-slc16a2 Fig. 7 from Campinho et al., 2014
trunk curved lateral, abnormal y1Tg + MO5-slc16a2 Fig. 2Fig. 3Fig. 4 from Campinho et al., 2014
whole organism decreased mobility, abnormal AB + MO5-slc16a2 Fig. 8 from Campinho et al., 2014
Phenotype of all Fish created by or utilizing MO5-slc16a2
Phenotype Fish Conditions Figures
trunk curved lateral, abnormal AB + MO4-tp53 + MO5-slc16a2 standard conditions Fig. 3 from Campinho et al., 2014
brain development disrupted, abnormal AB + MO4-tp53 + MO5-slc16a2 standard conditions Fig. 3 from Campinho et al., 2014
apoptotic process increased occurrence, abnormal AB + MO4-tp53 + MO5-slc16a2 standard conditions Fig. 3 from Campinho et al., 2014
whole organism decreased mobility, abnormal AB + MO5-slc16a2 standard conditions Fig. 8 from Campinho et al., 2014
forebrain neurod6b expression decreased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 3 with image from Silva et al., 2017
spinal cord neuron decreased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 5 from Campinho et al., 2014
embryonic camera-type eye development disrupted, abnormal AB + MO5-slc16a2 standard conditions Fig. 6 from Campinho et al., 2014
hindbrain wnt1 expression decreased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 2 with image from Silva et al., 2017
hindbrain her2 expression decreased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 2 with image from Silva et al., 2017
hindbrain flt4 expression decreased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 4 with image from Silva et al., 2017
hindbrain pax6a expression decreased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 3 with image from Silva et al., 2017
dorsal aorta flt4 expression increased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 4 with image from Silva et al., 2017
posterior cardinal vein flt4 expression increased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 4 with image from Silva et al., 2017
trunk curved lateral, abnormal AB + MO5-slc16a2 standard conditions Fig. 2Fig. 3 from Campinho et al., 2014
hindbrain wls expression increased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 2 with image from Silva et al., 2017
cranial nerve V neuron decreased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 7 from Campinho et al., 2014
primordial hindbrain channel hypoplastic, abnormal AB + MO5-slc16a2 standard conditions Fig. 4 with image from Silva et al., 2017
brain wls expression increased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 2 with image from Silva et al., 2017
midbrain rorab expression decreased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 3 with image from Silva et al., 2017
spinal cord development disrupted, abnormal AB + MO5-slc16a2 standard conditions Fig. 5 from Campinho et al., 2014
hindbrain dla expression decreased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 2 with image from Silva et al., 2017
spinal cord pax6a expression decreased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 3 with image from Silva et al., 2017
hindbrain interneuron decreased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 7 from Campinho et al., 2014
brain development disrupted, abnormal AB + MO5-slc16a2 standard conditions Fig. 2Fig. 3Fig. 5 from Campinho et al., 2014
spinal cord wls expression increased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 2 with image from Silva et al., 2017
spinal cord gad1b expression spatial pattern, abnormal AB + MO5-slc16a2 standard conditions Fig. 3 with image from Silva et al., 2017
midbrain her2 expression decreased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 2 with image from Silva et al., 2017
hindbrain gad1b expression decreased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 3 with image from Silva et al., 2017
brain pax6a expression decreased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 3 with image from Silva et al., 2017
midbrain decreased size, abnormal AB + MO5-slc16a2 standard conditions Fig. 5 from Campinho et al., 2014
spinal cord dla expression decreased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 2 with image from Silva et al., 2017
apoptotic process increased occurrence, abnormal AB + MO5-slc16a2 standard conditions Fig. 3 from Campinho et al., 2014
spinal cord her2 expression decreased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 2 with image from Silva et al., 2017
spinal cord interneuron decreased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 7 from Campinho et al., 2014
cranial vasculature morphology, abnormal AB + MO5-slc16a2 standard conditions Fig. 4 with image from Silva et al., 2017
optic cup rorab expression decreased amount, abnormal AB + MO5-slc16a2 standard conditions Fig. 3 with image from Silva et al., 2017
hindbrain ventral region vegfaa expression decreased distribution, abnormal y1Tg + MO5-slc16a2 standard conditions Fig. 5 with image from Trindade et al., 2025
cerebellum vasculature development disrupted, abnormal y1Tg + MO5-slc16a2 standard conditions Fig. 4 from Campinho et al., 2014
hindbrain vegfaa expression decreased distribution, abnormal y1Tg + MO5-slc16a2 standard conditions Fig. 1 with image from Trindade et al., 2025
hindbrain slc16a2 expression absent, abnormal y1Tg + MO5-slc16a2 standard conditions Fig. 7 with image from Trindade et al., 2025
hindbrain has fewer parts of type central artery, abnormal y1Tg + MO5-slc16a2 standard conditions Fig. 1 with image from Trindade et al., 2025
hindbrain brain vasculature lacks parts or has fewer parts of type central artery, abnormal y1Tg + MO5-slc16a2 standard conditions Fig. 5 with imageFig. 9 with image from Trindade et al., 2025
hindbrain ventral region vegfaa expression decreased amount, abnormal y1Tg + MO5-slc16a2 standard conditions Fig. 5 with image from Trindade et al., 2025
trunk curved lateral, abnormal y1Tg + MO5-slc16a2 standard conditions Fig. 4 from Campinho et al., 2014
central artery vasculature development delayed, abnormal y1Tg + MO5-slc16a2 standard conditions Fig. 2 with image from Trindade et al., 2025
hindbrain posterior region pax8 expression absent, abnormal y1Tg + MO5-slc16a2 control Fig. 3 with image from Trindade et al., 2025
hindbrain ventral region pax6a expression decreased amount, abnormal y1Tg + MO5-slc16a2 standard conditions Fig. 5 with image from Trindade et al., 2025
basilar artery vasculature development delayed, abnormal y1Tg + MO5-slc16a2 standard conditions Fig. 2 with image from Trindade et al., 2025
basilar artery has fewer parts of type basilar artery pericyte, abnormal y1Tg + MO5-slc16a2 standard conditions Fig. 2 with image from Trindade et al., 2025
basilar artery has extra parts of type basilar artery pericyte, abnormal y1Tg + MO5-slc16a2 standard conditions Fig. 2 with image from Trindade et al., 2025
hindbrain posterior region pax8 expression decreased amount, abnormal y1Tg + MO5-slc16a2 control Fig. 3 with image from Trindade et al., 2025
hindbrain ventral region pax6a expression decreased distribution, abnormal y1Tg + MO5-slc16a2 standard conditions Fig. 5 with image from Trindade et al., 2025
central artery lacks all parts of type central artery pericyte, abnormal y1Tg + MO5-slc16a2 standard conditions Fig. 2 with image from Trindade et al., 2025
hindbrain vasculature development decreased process quality, abnormal y1Tg + MO5-slc16a2 standard conditions Fig. 1 with imageFig. 5 with imageFig. 9 with image from Trindade et al., 2025
primordial hindbrain channel vasculature development delayed, abnormal y1Tg + MO5-slc16a2 standard conditions Fig. 2 with image from Trindade et al., 2025
hindbrain vegfaa expression decreased amount, abnormal y1Tg + MO5-slc16a2 standard conditions Fig. 1 with image from Trindade et al., 2025
central artery sprouting angiogenesis decreased process quality, abnormal y1Tg + MO5-slc16a2 standard conditions Fig. 6 with image from Trindade et al., 2025
primordial hindbrain channel has fewer parts of type primordial hindbrain channel pericyte, abnormal y1Tg + MO5-slc16a2 standard conditions Fig. 2 with image from Trindade et al., 2025
hindbrain posterior region pax8 expression decreased distribution, abnormal y1Tg + MO5-slc16a2 control Fig. 3 with image from Trindade et al., 2025
hindbrain has fewer parts of type motor neuron, abnormal nkgSA2AzGFF306AGt; nkuasgfp1aTg; y171Tg + MO5-slc16a2 standard conditions Fig. 4 with image from Trindade et al., 2025
Citations