Morpholino

MO3-ap1m2

ID
ZDB-MRPHLNO-140716-1
Name
MO3-ap1m2
Previous Names
None
Target
Sequence
5' - CACACACACCCCAGACTGACCAGCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO. The author was contacted and provided this corrected morpholino sequence.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-ap1m2
Phenotype
Phenotype resulting from MO3-ap1m2
No data available
Phenotype of all Fish created by or utilizing MO3-ap1m2
Phenotype Fish Conditions Figures
midbrain malformed, abnormal AB + MO1-ap1m1 + MO3-ap1m2 standard conditions Fig. 6 with image from Gariano et al., 2014
intestine establishment of cell polarity disrupted, abnormal AB + MO1-ap1m1 + MO3-ap1m2 standard conditions Fig. 9 with image from Gariano et al., 2014
myotome organization quality, abnormal AB + MO1-ap1m1 + MO3-ap1m2 standard conditions Fig. 9 with image from Gariano et al., 2014
diencephalon morphology, abnormal AB + MO1-ap1m1 + MO3-ap1m2 standard conditions Fig. 6 with image from Gariano et al., 2014
telencephalon morphology, abnormal AB + MO1-ap1m1 + MO3-ap1m2 standard conditions Fig. 6 with image from Gariano et al., 2014
brain morphology, abnormal AB + MO1-ap1m1 + MO3-ap1m2 standard conditions Fig. 6 with image from Gariano et al., 2014
brain apoptotic process increased occurrence, abnormal AB + MO1-ap1m1 + MO3-ap1m2 standard conditions Fig. 6 with image from Gariano et al., 2014
pronephric duct morphology, abnormal AB + MO1-ap1m1 + MO3-ap1m2 standard conditions Fig. 9 with image from Gariano et al., 2014
glomerular filtration disrupted, abnormal AB + MO1-ap1m1 + MO3-ap1m2 standard conditions Fig. 11 with image from Gariano et al., 2014
forebrain ventricle morphology, abnormal AB + MO1-ap1m1 + MO3-ap1m2 standard conditions Fig. 6 with image from Gariano et al., 2014
liver morphology, abnormal AB + MO1-ap1m1 + MO3-ap1m2 standard conditions Fig. 9 with image from Gariano et al., 2014
pericardium edematous, abnormal AB + MO1-ap1m1 + MO3-ap1m2 standard conditions Fig. 6 with imageFig. 10 with image from Gariano et al., 2014
midbrain hindbrain boundary morphology, abnormal AB + MO1-ap1m1 + MO3-ap1m2 standard conditions Fig. 6 with image from Gariano et al., 2014
pronephric duct morphogenesis disrupted, abnormal AB + MO1-ap1m1 + MO3-ap1m2 standard conditions Fig. 9 with image from Gariano et al., 2014
hindbrain morphology, abnormal AB + MO1-ap1m1 + MO3-ap1m2 standard conditions Fig. 6 with image from Gariano et al., 2014
midbrain morphology, abnormal AB + MO1-ap1m1 + MO3-ap1m2 standard conditions Fig. 6 with image from Gariano et al., 2014
pronephric duct proximal region morphology, abnormal AB + MO1-ap1m1 + MO3-ap1m2 standard conditions Fig. 6 with image from Gariano et al., 2014
ball edematous, abnormal AB + MO1-ap1m1 + MO3-ap1m2 standard conditions Fig. 10 with image from Gariano et al., 2014
Citations