Morpholino

MO5-sulf1

ID
ZDB-MRPHLNO-140609-1
Name
MO5-sulf1
Previous Names
  • sulf1MOATG (1)
Target
Sequence
5' - AACGCGAATCAGAAGGTTGGAATCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-sulf1
Expressed Gene Anatomy Figures
arxa Fig. S3 with image from Al Oustah et al., 2014
foxa2 Fig. 5 with image from Al Oustah et al., 2014
isl2a Fig. 2 with image from Al Oustah et al., 2014
nkx2.2a Fig. 5 with image from Al Oustah et al., 2014
nkx2.9 Fig. S3 with image from Al Oustah et al., 2014
olig2 Fig. 5 with image from Al Oustah et al., 2014
pax2a Fig. 2 with image from Al Oustah et al., 2014
pax7a Fig. S3 with image from Al Oustah et al., 2014
ptch2 Fig. S5 with image from Al Oustah et al., 2014
shha Fig. 6 with image from Al Oustah et al., 2014
sim1a Fig. 2 with image from Al Oustah et al., 2014
tal2 Fig. 2 with image from Al Oustah et al., 2014
Phenotype
Phenotype resulting from MO5-sulf1
Phenotype Fish Figures
neural tube smoothened signaling pathway decreased process quality, abnormal WT + MO5-sulf1 Fig. S5 with image from Al Oustah et al., 2014
spinal cord has fewer parts of type spinal cord interneuron, abnormal WT + MO5-sulf1 Fig. 2 with image from Al Oustah et al., 2014
spinal cord has fewer parts of type Kolmer-Agduhr neuron, abnormal WT + MO5-sulf1 Fig. 2 with image from Al Oustah et al., 2014
spinal cord has fewer parts of type oligodendrocyte, abnormal vu12Tg + MO5-sulf1 Fig. 1 with image from Al Oustah et al., 2014
spinal cord smoothened signaling pathway decreased process quality, abnormal WT + MO5-sulf1 Fig. S5 with image from Al Oustah et al., 2014
spinal cord ventral region poorly differentiated, abnormal WT + MO5-sulf1 Fig. 5 with image from Al Oustah et al., 2014
spinal cord oligodendrocyte cell differentiation decreased occurrence, abnormal vu12Tg + MO5-sulf1 Fig. 1 with image from Al Oustah et al., 2014
ventral spinal cord development process quality, abnormal WT + MO5-sulf1 Fig. 5 with image from Al Oustah et al., 2014
ventral spinal cord interneuron differentiation decreased occurrence, abnormal WT + MO5-sulf1 Fig. 2 with image from Al Oustah et al., 2014
Phenotype of all Fish created by or utilizing MO5-sulf1
Phenotype Fish Conditions Figures
spinal cord has fewer parts of type Kolmer-Agduhr neuron, abnormal WT + MO5-sulf1 standard conditions Fig. 2 with image from Al Oustah et al., 2014
spinal cord has fewer parts of type spinal cord interneuron, abnormal WT + MO5-sulf1 standard conditions Fig. 2 with image from Al Oustah et al., 2014
ventral spinal cord interneuron differentiation decreased occurrence, abnormal WT + MO5-sulf1 standard conditions Fig. 2 with image from Al Oustah et al., 2014
ventral spinal cord development process quality, abnormal WT + MO5-sulf1 standard conditions Fig. 5 with image from Al Oustah et al., 2014
spinal cord ventral region poorly differentiated, abnormal WT + MO5-sulf1 standard conditions Fig. 5 with image from Al Oustah et al., 2014
neural tube smoothened signaling pathway decreased process quality, abnormal WT + MO5-sulf1 standard conditions Fig. S5 with image from Al Oustah et al., 2014
spinal cord smoothened signaling pathway decreased process quality, abnormal WT + MO5-sulf1 standard conditions Fig. S5 with image from Al Oustah et al., 2014
spinal cord oligodendrocyte cell differentiation decreased occurrence, abnormal vu12Tg + MO5-sulf1 standard conditions Fig. 1 with image from Al Oustah et al., 2014
spinal cord has fewer parts of type oligodendrocyte, abnormal vu12Tg + MO5-sulf1 standard conditions Fig. 1 with image from Al Oustah et al., 2014
spinal cord oligodendrocyte cell differentiation decreased occurrence, abnormal vu17Tg; vu19Tg + MO5-sulf1 standard conditions Fig. 1 with image from Al Oustah et al., 2014
spinal cord has fewer parts of type oligodendrocyte, abnormal vu17Tg; vu19Tg + MO5-sulf1 standard conditions Fig. 1 with image from Al Oustah et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.