Morpholino

MO5-sulf1

ID

ZDB-MRPHLNO-140609-1

Name

MO5-sulf1

Previous Names

sulf1MOATG (1)

Target

sulf1 (1)

Sequence

5' - AACGCGAATCAGAAGGTTGGAATCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO5-sulf1

No data available

Phenotype

Phenotype resulting from MO5-sulf1

Phenotype	Fish	Figures
neural tube smoothened signaling pathway decreased process quality, abnormal	WT + MO5-sulf1	Fig. S5 from Al Oustah et al., 2014
spinal cord has fewer parts of type Kolmer-Agduhr neuron, abnormal	WT + MO5-sulf1	Fig. 2 from Al Oustah et al., 2014
spinal cord has fewer parts of type spinal cord interneuron, abnormal	WT + MO5-sulf1	Fig. 2 from Al Oustah et al., 2014
spinal cord has fewer parts of type oligodendrocyte, abnormal	vu12Tg + MO5-sulf1	Fig. 1 from Al Oustah et al., 2014
spinal cord smoothened signaling pathway decreased process quality, abnormal	WT + MO5-sulf1	Fig. S5 from Al Oustah et al., 2014
spinal cord ventral region poorly differentiated, abnormal	WT + MO5-sulf1	Fig. 5 from Al Oustah et al., 2014
spinal cord oligodendrocyte cell differentiation decreased occurrence, abnormal	vu17Tg; vu19Tg + MO5-sulf1	Fig. 1 from Al Oustah et al., 2014
ventral spinal cord development process quality, abnormal	WT + MO5-sulf1	Fig. 5 from Al Oustah et al., 2014
ventral spinal cord interneuron differentiation decreased occurrence, abnormal	WT + MO5-sulf1	Fig. 2 from Al Oustah et al., 2014

Phenotype of all Fish created by or utilizing MO5-sulf1

Phenotype	Fish	Conditions	Figures
spinal cord has fewer parts of type Kolmer-Agduhr neuron, abnormal	WT + MO5-sulf1	standard conditions	Fig. 2 from Al Oustah et al., 2014
spinal cord has fewer parts of type spinal cord interneuron, abnormal	WT + MO5-sulf1	standard conditions	Fig. 2 from Al Oustah et al., 2014
ventral spinal cord interneuron differentiation decreased occurrence, abnormal	WT + MO5-sulf1	standard conditions	Fig. 2 from Al Oustah et al., 2014
ventral spinal cord development process quality, abnormal	WT + MO5-sulf1	standard conditions	Fig. 5 from Al Oustah et al., 2014
spinal cord ventral region poorly differentiated, abnormal	WT + MO5-sulf1	standard conditions	Fig. 5 from Al Oustah et al., 2014
neural tube smoothened signaling pathway decreased process quality, abnormal	WT + MO5-sulf1	standard conditions	Fig. S5 from Al Oustah et al., 2014
spinal cord smoothened signaling pathway decreased process quality, abnormal	WT + MO5-sulf1	standard conditions	Fig. S5 from Al Oustah et al., 2014
spinal cord oligodendrocyte cell differentiation decreased occurrence, abnormal	vu12Tg + MO5-sulf1	standard conditions	Fig. 1 from Al Oustah et al., 2014
spinal cord has fewer parts of type oligodendrocyte, abnormal	vu12Tg + MO5-sulf1	standard conditions	Fig. 1 from Al Oustah et al., 2014
spinal cord oligodendrocyte cell differentiation decreased occurrence, abnormal	vu17Tg; vu19Tg + MO5-sulf1	standard conditions	Fig. 1 from Al Oustah et al., 2014
spinal cord has fewer parts of type oligodendrocyte, abnormal	vu17Tg; vu19Tg + MO5-sulf1	standard conditions	Fig. 1 from Al Oustah et al., 2014

Citations