Morpholino

MO1-sept15

ID
ZDB-MRPHLNO-140606-7
Name
MO1-sept15
Previous Names
  • TBMO (1)
Target
Sequence
5' - TCGGGTCTCTCGATCATTGTCCTGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sept15
Phenotype
Phenotype resulting from MO1-sept15
Phenotype Fish Figures
atrium elongated, abnormal WT + MO1-sept15 Fig. 2 from Dash et al., 2017
brain hydrocephalic, abnormal WT + MO1-sept15 Fig. 7 with image from Dash et al., 2014
cardiac ventricle sept15 expression absent, abnormal WT + MO1-sept15 Fig. 2 from Dash et al., 2017
cardiac ventricle decreased size, abnormal WT + MO1-sept15 Fig. 2Fig. 5 from Dash et al., 2017
central canal has fewer parts of type ependymal cell cilium, abnormal WT + MO1-sept15 Fig. 7 with image from Dash et al., 2014
cilium assembly decreased process quality, abnormal li1Tg + MO1-sept15 Fig. 5 with image from Dash et al., 2014
embryonic heart tube left/right pattern formation decreased process quality, abnormal WT + MO1-sept15 Fig. 7 with image from Dash et al., 2014
endocrine pancreas has fewer parts of type pancreatic A cell, abnormal ia1Tg + MO1-sept15 Fig. 3 with image from Dash et al., 2016
endocrine pancreas has fewer parts of type pancreatic B cell, abnormal WT + MO1-sept15 Fig. 2 with image from Dash et al., 2016
endocrine pancreas development decreased process quality, abnormal nl1Tg + MO1-sept15 Fig. 7 with image from Dash et al., 2016
endoderm shha expression absent, abnormal WT + MO1-sept15 Fig. 6 with image from Dash et al., 2016
ependymal cell cilium decreased length, abnormal WT + MO1-sept15 Fig. 7 with image from Dash et al., 2014
ependymal cell cilium disoriented, abnormal WT + MO1-sept15 Fig. 7 with image from Dash et al., 2014
exocrine pancreas decreased length, abnormal WT + MO1-sept15 Fig. 4 with image from Dash et al., 2016
exocrine pancreas malformed, abnormal jh1Tg + MO1-sept15 Fig. 4 with image from Dash et al., 2016
exocrine pancreas EGFP expression mislocalised, abnormal nl1Tg + MO1-sept15 Fig. 7 with image from Dash et al., 2016
exocrine pancreas development decreased process quality, abnormal jh1Tg + MO1-sept15 Fig. 4 with image from Dash et al., 2016
glomerular filtration decreased process quality, abnormal WT + MO1-sept15 Fig. 4 with image from Dash et al., 2014
gut epithelium EGFP expression mislocalised, abnormal nl1Tg + MO1-sept15 Fig. 7 with image from Dash et al., 2016
gut epithelium ins expression mislocalised, abnormal nl1Tg + MO1-sept15 Fig. 7 with image from Dash et al., 2016
heart sept15 expression absent, abnormal WT + MO1-sept15 Fig. 2 from Dash et al., 2017
heart aldh1a2 expression decreased amount, abnormal WT + MO1-sept15 Fig. 7 from Dash et al., 2017
heart edematous, abnormal WT + MO1-sept15 Fig. 2 with image from Dash et al., 2014
heart morphology, abnormal WT + MO1-sept15 Fig. 2 from Dash et al., 2017
heart cardiac myofibril disorganized, abnormal WT + MO1-sept15 Fig. 2Fig. 3 from Dash et al., 2017
heart striated muscle myosin thick filament disorganized, abnormal WT + MO1-sept15 Fig. 2 from Dash et al., 2017
heart striated muscle thin filament Ab2-actc1 labeling decreased amount, abnormal WT + MO1-sept15 Fig. 4 from Dash et al., 2017
heart striated muscle thin filament disorganized, abnormal WT + MO1-sept15 Fig. 2 from Dash et al., 2017
heart Z disc absent, abnormal WT + MO1-sept15 Fig. 3 from Dash et al., 2017
heart Z disc disorganized, abnormal WT + MO1-sept15 Fig. 3 from Dash et al., 2017
heart Z disc structure, abnormal WT + MO1-sept15 Fig. 3 from Dash et al., 2017
heart contraction decreased process quality, abnormal WT + MO1-sept15 Fig. 5Fig. 7 from Dash et al., 2017
heart contraction decreased rate, abnormal WT + MO1-sept15 Fig. 5 from Dash et al., 2017
heart contraction process quality, abnormal WT + MO1-sept15 Fig. 7 from Dash et al., 2017
heart looping decreased occurrence, abnormal WT + MO1-sept15 Fig. 2Fig. 5 from Dash et al., 2017
heart tube bilateral symmetry, abnormal WT + MO1-sept15 Fig. 7 with image from Dash et al., 2014
intrapancreatic duct ins expression mislocalised, abnormal nl1Tg + MO1-sept15 Fig. 7 with image from Dash et al., 2016
intrapancreatic duct EGFP expression mislocalised, abnormal nl1Tg + MO1-sept15 Fig. 7 with image from Dash et al., 2016
islet cell differentiation decreased process quality, abnormal jh1Tg + MO1-sept15 Fig. 5 with image from Dash et al., 2016
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO1-sept15 Fig. 5 with image from Dash et al., 2014
lateral plate mesoderm bilateral symmetry, abnormal WT + MO1-sept15 Fig. 7 with image from Dash et al., 2014
muscle muscle tendon junction sept15 expression absent, abnormal WT + MO1-sept15 Fig. 2 from Dash et al., 2017
pancreas pancreatic A cell differentiation decreased occurrence, abnormal ia1Tg + MO1-sept15 Fig. 3 with image from Dash et al., 2016
pancreatic B cell cell population proliferation decreased occurrence, abnormal WT + MO1-sept15 Fig. 2 with image from Dash et al., 2016
post-vent region curved, abnormal WT + MO1-sept15 Fig. 2 with image from Dash et al., 2014
pronephric capsular space dilated, abnormal WT + MO1-sept15 Fig. 2 with image from Dash et al., 2014
pronephric podocyte lacks parts or has fewer parts of type pronephric podocyte slit diaphragm, abnormal WT + MO1-sept15 Fig. 3 with image from Dash et al., 2014
pronephric podocyte apical part of cell malformed, abnormal WT + MO1-sept15 Fig. 3 with image from Dash et al., 2014
pronephric podocyte cell projection malformed, abnormal WT + MO1-sept15 Fig. 3 with image from Dash et al., 2014
pronephric tubule dilated, abnormal WT + MO1-sept15 Fig. 2 with imageFig. 3 with image from Dash et al., 2014
pronephric tubule has fewer parts of type pronephric tubule microvillus, abnormal WT + MO1-sept15 Fig. 3 with image from Dash et al., 2014
pronephric tubule increased diameter, abnormal WT + MO1-sept15 Fig. 5 with image from Dash et al., 2014
pronephric tubule actin cytoskeleton decreased object quality, abnormal WT + MO1-sept15 Fig. 6 with image from Dash et al., 2014
pronephric tubule apical part of cell physical object quality, abnormal WT + MO1-sept15 Fig. 6 with image from Dash et al., 2014
pronephric tubule ciliary basal body disorganized, abnormal WT + MO1-sept15 Fig. 5 with image from Dash et al., 2014
pronephric tubule motile cilium decreased length, abnormal li1Tg + MO1-sept15 Fig. 5 with image from Dash et al., 2014
pronephric tubule motile cilium disoriented, abnormal WT + MO1-sept15 Fig. 5 with image from Dash et al., 2014
pronephros cystic, abnormal WT + MO1-sept15 Fig. 2 with image from Dash et al., 2014
pronephros morphogenesis decreased process quality, abnormal WT + MO1-sept15 Fig. 2 with imageFig. 3 with image from Dash et al., 2014
renal water transport decreased process quality, abnormal WT + MO1-sept15 Fig. 4 with image from Dash et al., 2014
whole organism notch1b expression decreased amount, abnormal WT + MO1-sept15 Fig. 6 with image from Dash et al., 2016
whole organism notch1a expression decreased amount, abnormal WT + MO1-sept15 Fig. 6 with image from Dash et al., 2016
whole organism ins expression decreased amount, abnormal WT + MO1-sept15 Fig. 8 with image from Dash et al., 2016
whole organism ascl1b expression increased amount, abnormal WT + MO1-sept15 Fig. 6 with image from Dash et al., 2016
whole organism pck1 expression increased amount, abnormal WT + MO1-sept15 Fig. 8 with image from Dash et al., 2016
whole organism anterior region aldh1a2 expression decreased amount, abnormal WT + MO1-sept15 Fig. 7 from Dash et al., 2017
whole organism glucose increased amount, abnormal WT + MO1-sept15 Fig. 8 with image from Dash et al., 2016
whole organism glucose homeostasis decreased process quality, abnormal WT + MO1-sept15 Fig. 8 with image from Dash et al., 2016
yolk edematous, abnormal WT + MO1-sept15 Fig. 2 with image from Dash et al., 2014
Phenotype of all Fish created by or utilizing MO1-sept15
Phenotype Fish Conditions Figures
pronephros morphogenesis decreased process quality, abnormal WT + MO1-sept15 standard conditions Fig. 2 with imageFig. 3 with image from Dash et al., 2014
lateral plate mesoderm bilateral symmetry, abnormal WT + MO1-sept15 standard conditions Fig. 7 with image from Dash et al., 2014
muscle muscle tendon junction sept15 expression absent, abnormal WT + MO1-sept15 standard conditions Fig. 2 from Dash et al., 2017
cilium assembly decreased process quality, abnormal WT + MO1-sept15 standard conditions Fig. 5 with image from Dash et al., 2014
pronephric tubule ciliary basal body disorganized, abnormal WT + MO1-sept15 standard conditions Fig. 5 with image from Dash et al., 2014
heart contraction decreased rate, abnormal WT + MO1-sept15 standard conditions Fig. 5 from Dash et al., 2017
whole organism pck1 expression increased amount, abnormal WT + MO1-sept15 control Fig. 8 with image from Dash et al., 2016
whole organism ascl1b expression increased amount, abnormal WT + MO1-sept15 standard conditions Fig. 6 with image from Dash et al., 2016
heart contraction decreased process quality, abnormal WT + MO1-sept15 control Fig. 5Fig. 7 from Dash et al., 2017
heart striated muscle thin filament Ab2-actc1 labeling decreased amount, abnormal WT + MO1-sept15 standard conditions Fig. 4 from Dash et al., 2017
embryonic heart tube left/right pattern formation decreased process quality, abnormal WT + MO1-sept15 standard conditions Fig. 7 with image from Dash et al., 2014
whole organism glucose homeostasis decreased process quality, abnormal WT + MO1-sept15 standard conditions Fig. 8 with image from Dash et al., 2016
pronephric tubule motile cilium disoriented, abnormal WT + MO1-sept15 standard conditions Fig. 5 with image from Dash et al., 2014
pronephric podocyte lacks parts or has fewer parts of type pronephric podocyte slit diaphragm, abnormal WT + MO1-sept15 standard conditions Fig. 3 with image from Dash et al., 2014
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO1-sept15 standard conditions Fig. 5 with image from Dash et al., 2014
pronephric capsular space dilated, abnormal WT + MO1-sept15 standard conditions Fig. 2 with image from Dash et al., 2014
endoderm shha expression absent, abnormal WT + MO1-sept15 standard conditions Fig. 6 with image from Dash et al., 2016
pronephros cystic, abnormal WT + MO1-sept15 standard conditions Fig. 2 with image from Dash et al., 2014
heart contraction decreased process quality, abnormal WT + MO1-sept15 chemical treatment: 4-(diethylamino)benzaldehyde Fig. 8 from Dash et al., 2017
heart sept15 expression absent, abnormal WT + MO1-sept15 standard conditions Fig. 2 from Dash et al., 2017
ependymal cell cilium disoriented, abnormal WT + MO1-sept15 standard conditions Fig. 7 with image from Dash et al., 2014
heart Z disc structure, abnormal WT + MO1-sept15 standard conditions Fig. 3 from Dash et al., 2017
whole organism glucose increased amount, abnormal WT + MO1-sept15 standard conditions Fig. 8 with image from Dash et al., 2016
heart tube bilateral symmetry, abnormal WT + MO1-sept15 standard conditions Fig. 7 with image from Dash et al., 2014
heart striated muscle thin filament disorganized, abnormal WT + MO1-sept15 standard conditions Fig. 2 from Dash et al., 2017
exocrine pancreas decreased length, abnormal WT + MO1-sept15 standard conditions Fig. 4 with image from Dash et al., 2016
pronephric tubule apical part of cell physical object quality, abnormal WT + MO1-sept15 standard conditions Fig. 6 with image from Dash et al., 2014
pronephric podocyte apical part of cell malformed, abnormal WT + MO1-sept15 standard conditions Fig. 3 with image from Dash et al., 2014
renal water transport decreased process quality, abnormal WT + MO1-sept15 standard conditions Fig. 4 with image from Dash et al., 2014
glomerular filtration decreased process quality, abnormal WT + MO1-sept15 standard conditions Fig. 4 with image from Dash et al., 2014
post-vent region curved, abnormal WT + MO1-sept15 standard conditions Fig. 2 with image from Dash et al., 2014
whole organism ins expression decreased amount, abnormal WT + MO1-sept15 chemical treatment by environment: glucose Fig. 8 with image from Dash et al., 2016
pronephric tubule actin cytoskeleton decreased object quality, abnormal WT + MO1-sept15 standard conditions Fig. 6 with image from Dash et al., 2014
heart contraction process quality, abnormal WT + MO1-sept15 chemical treatment: retinoic acid Fig. 7 from Dash et al., 2017
cardiac ventricle decreased size, abnormal WT + MO1-sept15 standard conditions Fig. 2Fig. 5 from Dash et al., 2017
whole organism notch1b expression decreased amount, abnormal WT + MO1-sept15 standard conditions Fig. 6 with image from Dash et al., 2016
brain hydrocephalic, abnormal WT + MO1-sept15 standard conditions Fig. 7 with image from Dash et al., 2014
ependymal cell cilium decreased length, abnormal WT + MO1-sept15 standard conditions Fig. 7 with image from Dash et al., 2014
heart aldh1a2 expression decreased amount, abnormal WT + MO1-sept15 standard conditions Fig. 7 from Dash et al., 2017
whole organism pck1 expression increased amount, abnormal WT + MO1-sept15 chemical treatment by environment: glucose Fig. 8 with image from Dash et al., 2016
heart striated muscle myosin thick filament disorganized, abnormal WT + MO1-sept15 standard conditions Fig. 2 from Dash et al., 2017
heart contraction process quality, abnormal WT + MO1-sept15 control Fig. 7 from Dash et al., 2017
heart edematous, abnormal WT + MO1-sept15 standard conditions Fig. 2 with image from Dash et al., 2014
heart morphology, abnormal WT + MO1-sept15 standard conditions Fig. 2 from Dash et al., 2017
pancreatic B cell cell population proliferation decreased occurrence, abnormal WT + MO1-sept15 control Fig. 2 with image from Dash et al., 2016
central canal has fewer parts of type ependymal cell cilium, abnormal WT + MO1-sept15 standard conditions Fig. 7 with image from Dash et al., 2014
whole organism anterior region aldh1a2 expression decreased amount, abnormal WT + MO1-sept15 standard conditions Fig. 7 from Dash et al., 2017
whole organism glucose homeostasis decreased process quality, abnormal WT + MO1-sept15 chemical treatment by environment: glucose Fig. 8 with image from Dash et al., 2016
pronephric podocyte cell projection malformed, abnormal WT + MO1-sept15 standard conditions Fig. 3 with image from Dash et al., 2014
heart looping decreased occurrence, abnormal WT + MO1-sept15 standard conditions Fig. 2Fig. 5 from Dash et al., 2017
heart contraction increased process quality, abnormal WT + MO1-sept15 chemical treatment: retinoic acid Fig. 7 from Dash et al., 2017
endocrine pancreas has fewer parts of type pancreatic B cell, abnormal WT + MO1-sept15 control Fig. 2 with image from Dash et al., 2016
pronephric tubule dilated, abnormal WT + MO1-sept15 standard conditions Fig. 2 with imageFig. 3 with image from Dash et al., 2014
cardiac ventricle sept15 expression absent, abnormal WT + MO1-sept15 standard conditions Fig. 2 from Dash et al., 2017
whole organism notch1a expression decreased amount, abnormal WT + MO1-sept15 standard conditions Fig. 6 with image from Dash et al., 2016
heart cardiac myofibril disorganized, abnormal WT + MO1-sept15 standard conditions Fig. 2Fig. 3 from Dash et al., 2017
pronephric tubule increased diameter, abnormal WT + MO1-sept15 standard conditions Fig. 5 with image from Dash et al., 2014
heart Z disc absent, abnormal WT + MO1-sept15 standard conditions Fig. 3 from Dash et al., 2017
pronephric tubule has fewer parts of type pronephric tubule microvillus, abnormal WT + MO1-sept15 standard conditions Fig. 3 with image from Dash et al., 2014
yolk edematous, abnormal WT + MO1-sept15 standard conditions Fig. 2 with image from Dash et al., 2014
atrium elongated, abnormal WT + MO1-sept15 standard conditions Fig. 2 from Dash et al., 2017
whole organism ins expression decreased amount, abnormal WT + MO1-sept15 control Fig. 8 with image from Dash et al., 2016
heart Z disc disorganized, abnormal WT + MO1-sept15 standard conditions Fig. 3 from Dash et al., 2017
endocrine pancreas has fewer parts of type pancreatic A cell, abnormal ia1Tg + MO1-sept15 standard conditions Fig. 3 with image from Dash et al., 2016
pancreas pancreatic A cell differentiation decreased occurrence, abnormal ia1Tg + MO1-sept15 standard conditions Fig. 3 with image from Dash et al., 2016
exocrine pancreas development decreased process quality, abnormal jh1Tg + MO1-sept15 standard conditions Fig. 4 with image from Dash et al., 2016
islet cell differentiation decreased process quality, abnormal jh1Tg + MO1-sept15 standard conditions Fig. 5 with image from Dash et al., 2016
exocrine pancreas malformed, abnormal jh1Tg + MO1-sept15 standard conditions Fig. 4 with image from Dash et al., 2016
pronephric tubule motile cilium decreased length, abnormal li1Tg + MO1-sept15 standard conditions Fig. 5 with image from Dash et al., 2014
cilium assembly decreased process quality, abnormal li1Tg + MO1-sept15 standard conditions Fig. 5 with image from Dash et al., 2014
gut epithelium EGFP expression mislocalised, abnormal nl1Tg + MO1-sept15 chemical treatment by environment: DAPT Fig. 7 with image from Dash et al., 2016
endocrine pancreas development decreased process quality, abnormal nl1Tg + MO1-sept15 chemical treatment by environment: DAPT Fig. 7 with image from Dash et al., 2016
intrapancreatic duct ins expression mislocalised, abnormal nl1Tg + MO1-sept15 control Fig. 7 with image from Dash et al., 2016
exocrine pancreas EGFP expression mislocalised, abnormal nl1Tg + MO1-sept15 control Fig. 7 with image from Dash et al., 2016
intrapancreatic duct EGFP expression mislocalised, abnormal nl1Tg + MO1-sept15 control Fig. 7 with image from Dash et al., 2016
gut epithelium ins expression mislocalised, abnormal nl1Tg + MO1-sept15 control Fig. 7 with image from Dash et al., 2016
endocrine pancreas development decreased process quality, abnormal nl1Tg + MO1-sept15 control Fig. 7 with image from Dash et al., 2016
gut epithelium EGFP expression mislocalised, abnormal nl1Tg + MO1-sept15 control Fig. 7 with image from Dash et al., 2016
exocrine pancreas EGFP expression mislocalised, abnormal nl1Tg + MO1-sept15 chemical treatment by environment: DAPT Fig. 7 with image from Dash et al., 2016
Citations