Morpholino

MO1-hsbp1b

ID
ZDB-MRPHLNO-140430-2
Name
MO1-hsbp1b
Previous Names
None
Target
Sequence
5' - CTGATTTTGGGTCTGTCTGTGCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hsbp1b
Phenotype
Phenotype resulting from MO1-hsbp1b
Phenotype Fish Figures
anatomical structure snai1b expression increased amount, abnormal WT + MO1-hsbp1b Fig. 5 with image from Eroglu et al., 2014
anatomical structure foxd3 expression increased amount, abnormal WT + MO1-hsbp1b Fig. 5 with image from Eroglu et al., 2014
central nervous system apoptotic, abnormal WT + MO1-hsbp1b text only from Eroglu et al., 2014
central nervous system physical object quality, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
central nervous system development disrupted, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
embryo development disrupted, abnormal WT + MO1-hsbp1b + MO4-tp53 Fig. S7 with image from Eroglu et al., 2014
forebrain hlx1 expression decreased amount, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
forebrain neural plate hesx1 expression increased distribution, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
head deformed, abnormal WT + MO1-hsbp1b + MO4-tp53 Fig. S7 with imageTable S3 with image from Eroglu et al., 2014
heart deformed, abnormal WT + MO1-hsbp1b + MO4-tp53 Table S3 with image from Eroglu et al., 2014
hindbrain hlx1 expression decreased amount, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
midbrain hlx1 expression decreased amount, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
midbrain hindbrain boundary en2a expression absent, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
midbrain hindbrain boundary neural keel en2a expression absent, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
midbrain hindbrain boundary neural plate en2a expression decreased distribution, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
neural crest formation process quality, abnormal WT + MO1-hsbp1b Fig. 5 with image from Eroglu et al., 2014
non neural ectoderm tfap2a expression increased amount, abnormal WT + MO1-hsbp1b Fig. 5 with image from Eroglu et al., 2014
notochord tbxta expression spatial pattern, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
presumptive rhombomere 3 egr2b expression decreased distribution, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
presumptive rhombomere 5 egr2b expression decreased distribution, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
rhombomere 3 egr2b expression decreased distribution, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
rhombomere 5 egr2b expression decreased distribution, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
whole organism cdh1 expression decreased amount, abnormal WT + MO1-hsbp1b Fig. 6 with image from Eroglu et al., 2014
whole organism decreased length, abnormal WT + MO1-hsbp1b Fig. S7 with image from Eroglu et al., 2014
whole organism hsph1 expression increased amount, abnormal WT + MO1-hsbp1b Fig. 6 with image from Eroglu et al., 2014
whole organism hsp70l expression increased amount, abnormal WT + MO1-hsbp1b Fig. 6 with image from Eroglu et al., 2014
whole organism snai1b expression increased amount, abnormal WT + MO1-hsbp1b Fig. 6 with image from Eroglu et al., 2014
whole organism foxd3 expression increased amount, abnormal WT + MO1-hsbp1b Fig. 6 with image from Eroglu et al., 2014
whole organism tfap2a expression increased amount, abnormal WT + MO1-hsbp1b Fig. 6 with image from Eroglu et al., 2014
whole organism hsp90aa1.2 expression increased amount, abnormal WT + MO1-hsbp1b Fig. 6 with image from Eroglu et al., 2014
whole organism snai2 expression increased amount, abnormal WT + MO1-hsbp1b Fig. 6 with image from Eroglu et al., 2014
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-hsbp1b Fig. S7 with imageTable S3 with image from Eroglu et al., 2014
yolk increased size, abnormal WT + MO1-hsbp1b + MO4-tp53 Table S3 with image from Eroglu et al., 2014
Phenotype of all Fish created by or utilizing MO1-hsbp1b
Phenotype Fish Conditions Figures
midbrain hindbrain boundary en2a expression absent, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
heart deformed, abnormal WT + MO1-hsbp1b standard conditions Table S3 with image from Eroglu et al., 2014
whole organism hsp70l expression increased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 6 with image from Eroglu et al., 2014
central nervous system physical object quality, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
yolk increased size, abnormal WT + MO1-hsbp1b standard conditions Table S3 with image from Eroglu et al., 2014
neural crest formation process quality, abnormal WT + MO1-hsbp1b standard conditions Fig. 5 with image from Eroglu et al., 2014
whole organism decreased length, abnormal WT + MO1-hsbp1b standard conditions Fig. S7 with image from Eroglu et al., 2014
forebrain neural plate hesx1 expression increased distribution, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
whole organism snai2 expression increased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 6 with image from Eroglu et al., 2014
rhombomere 5 egr2b expression decreased distribution, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
embryo development disrupted, abnormal WT + MO1-hsbp1b standard conditions Fig. S7 with image from Eroglu et al., 2014
whole organism hsp90aa1.2 expression increased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 6 with image from Eroglu et al., 2014
rhombomere 3 egr2b expression decreased distribution, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
central nervous system apoptotic, abnormal WT + MO1-hsbp1b standard conditions text only from Eroglu et al., 2014
notochord tbxta expression spatial pattern, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
midbrain hindbrain boundary neural keel en2a expression absent, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
anatomical structure snai1b expression increased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 5 with image from Eroglu et al., 2014
presumptive rhombomere 3 egr2b expression decreased distribution, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
presumptive rhombomere 5 egr2b expression decreased distribution, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
whole organism snai1b expression increased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 6 with image from Eroglu et al., 2014
non neural ectoderm tfap2a expression increased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 5 with image from Eroglu et al., 2014
midbrain hlx1 expression decreased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
forebrain hlx1 expression decreased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-hsbp1b standard conditions Fig. S7 with imageTable S3 with image from Eroglu et al., 2014
head deformed, abnormal WT + MO1-hsbp1b standard conditions Fig. S7 with imageTable S3 with image from Eroglu et al., 2014
central nervous system development disrupted, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
whole organism tfap2a expression increased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 6 with image from Eroglu et al., 2014
midbrain hindbrain boundary neural plate en2a expression decreased distribution, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
anatomical structure foxd3 expression increased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 5 with image from Eroglu et al., 2014
whole organism foxd3 expression increased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 6 with image from Eroglu et al., 2014
hindbrain hlx1 expression decreased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
whole organism cdh1 expression decreased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 6 with image from Eroglu et al., 2014
whole organism hsph1 expression increased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 6 with image from Eroglu et al., 2014
embryo development disrupted, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Fig. S7 with image from Eroglu et al., 2014
yolk increased size, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Table S3 with image from Eroglu et al., 2014
head deformed, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Fig. S7 with imageTable S3 with image from Eroglu et al., 2014
heart deformed, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Table S3 with image from Eroglu et al., 2014
whole organism decreased length, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Fig. S7 with image from Eroglu et al., 2014
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Fig. S7 with imageTable S3 with image from Eroglu et al., 2014
Citations