Morpholino

MO5-etv5a

ID
ZDB-MRPHLNO-140402-3
Name
MO5-etv5a
Previous Names
None
Target
Sequence
5' - TCACCTGGGTCTTCAAAGAGGCTCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-etv5a
No data available
Phenotype
Phenotype resulting from MO5-etv5a
Phenotype Fish Figures
angiogenesis disrupted, abnormal y1Tg + MO5-etv5a Fig. 3 from Chen et al., 2013
apoptotic process increased occurrence, abnormal TU + MO5-etv5a Fig. 5 from Chen et al., 2013
blood cell decreased amount, abnormal TU + MO5-etv5a text only from Chen et al., 2013
blood vessel development disrupted, abnormal y1Tg + MO5-etv5a Fig. 3 from Chen et al., 2013
common lymphoid progenitor decreased amount, abnormal TU + MO5-etv5a Fig. 2 from Chen et al., 2013
erythroid lineage cell decreased amount, abnormal TU + MO5-etv5a + MO5-tp53 Fig. 2 from Chen et al., 2013
granulocyte decreased amount, abnormal TU + MO5-etv5a Fig. 2 from Chen et al., 2013
heart contraction decreased rate, abnormal TU + MO5-etv5a text only from Chen et al., 2013
hemangioblast cell differentiation disrupted, abnormal TU + MO5-etv5a Fig. 2 from Chen et al., 2013
hematopoietic stem cell decreased amount, abnormal TU + MO5-etv5a Fig. 2 from Chen et al., 2013
hematopoietic stem cell differentiation disrupted, abnormal TU + MO5-etv5a + MO5-tp53 Fig. 2 from Chen et al., 2013
hemopoiesis disrupted, abnormal TU + MO5-etv5a + MO5-tp53 Fig. 2 from Chen et al., 2013
intersegmental vessel morphology, abnormal y1Tg + MO5-etv5a Fig. 3 from Chen et al., 2013
pronephric nephron tubule epithelial cell differentiation process quality, abnormal WT + MO5-etv5a Fig. 3 with image from Marra et al., 2016
pronephric proximal straight tubule has fewer parts of type pronephric proximal straight tubule multi-ciliated epithelial cell, abnormal WT + MO5-etv5a Fig. 3 with image from Marra et al., 2016
pronephros multi-ciliated epithelial cell differentiation decreased occurrence, abnormal WT + MO5-etv5a Fig. 3 with image from Marra et al., 2016
subintestinal vein hypoplastic, abnormal y1Tg + MO5-etv5a Fig. 3 from Chen et al., 2013
ventral mesoderm cell population proliferation increased occurrence, abnormal TU + MO5-etv5a Fig. 4 from Chen et al., 2013
Phenotype of all Fish created by or utilizing MO5-etv5a
Phenotype Fish Conditions Figures
hemangioblast cell differentiation disrupted, abnormal TU + MO5-etv5a standard conditions Fig. 2 from Chen et al., 2013
blood cell decreased amount, abnormal TU + MO5-etv5a standard conditions text only from Chen et al., 2013
apoptotic process increased occurrence, abnormal TU + MO5-etv5a standard conditions Fig. 5 from Chen et al., 2013
ventral mesoderm cell population proliferation increased occurrence, abnormal TU + MO5-etv5a standard conditions Fig. 4 from Chen et al., 2013
heart contraction decreased rate, abnormal TU + MO5-etv5a standard conditions text only from Chen et al., 2013
hematopoietic stem cell decreased amount, abnormal TU + MO5-etv5a standard conditions Fig. 2 from Chen et al., 2013
hematopoietic stem cell differentiation disrupted, abnormal TU + MO5-etv5a standard conditions Fig. 2 from Chen et al., 2013
erythroid lineage cell decreased amount, abnormal TU + MO5-etv5a standard conditions Fig. 2 from Chen et al., 2013
granulocyte decreased amount, abnormal TU + MO5-etv5a standard conditions Fig. 2 from Chen et al., 2013
common lymphoid progenitor decreased amount, abnormal TU + MO5-etv5a standard conditions Fig. 2 from Chen et al., 2013
common lymphoid progenitor decreased amount, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
hemopoiesis disrupted, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
hematopoietic stem cell differentiation disrupted, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
hemangioblast cell differentiation disrupted, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
hematopoietic stem cell decreased amount, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
erythroid lineage cell decreased amount, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
granulocyte decreased amount, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
pronephric proximal straight tubule has fewer parts of type pronephric proximal straight tubule multi-ciliated epithelial cell, abnormal WT + MO5-etv5a standard conditions Fig. 3 with image from Marra et al., 2016
pronephros multi-ciliated epithelial cell differentiation decreased occurrence, abnormal WT + MO5-etv5a standard conditions Fig. 3 with image from Marra et al., 2016
pronephric nephron tubule epithelial cell differentiation process quality, abnormal WT + MO5-etv5a standard conditions Fig. 3 with image from Marra et al., 2016
subintestinal vein hypoplastic, abnormal y1Tg + MO5-etv5a standard conditions Fig. 3 from Chen et al., 2013
blood vessel development disrupted, abnormal y1Tg + MO5-etv5a standard conditions Fig. 3 from Chen et al., 2013
angiogenesis disrupted, abnormal y1Tg + MO5-etv5a standard conditions Fig. 3 from Chen et al., 2013
intersegmental vessel morphology, abnormal y1Tg + MO5-etv5a standard conditions Fig. 3 from Chen et al., 2013
Citations