Morpholino

MO1-tet2

ID

ZDB-MRPHLNO-140402-10

Name

MO1-tet2

Previous Names

zTET2 MO (1)

Target

tet2 (1)

Sequence

5' - ATTGCTGGTCTTTTCTGTTTCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tet2

Expressed Gene	Anatomy	Figures
gata1a	erythroid lineage cell intermediate cell mass of mesoderm	Fig. 6, Fig. 9 from Ge et al., 2014
myb	dorsal aorta erythroid lineage cell	Fig. 6 from Ge et al., 2014
runx1	dorsal aorta erythroid lineage cell	Fig. 6 from Ge et al., 2014
tal1	erythroid lineage cell intermediate cell mass of mesoderm	Fig. 6 from Ge et al., 2014

Phenotype

Phenotype resulting from MO1-tet2

Phenotype	Fish	Figures
broad specificity oxidative DNA demethylase activity disrupted, abnormal	AB + MO1-tet2	Fig. 7 from Ge et al., 2014
erythrocyte differentiation disrupted, abnormal	AB + MO1-tet2	Fig. 5, Fig. 9 from Ge et al., 2014
erythroid progenitor cell increased accumulation intermediate cell mass of mesoderm, abnormal	AB + MO1-tet2	Fig. 9 from Ge et al., 2014
intermediate cell mass of mesoderm erythroid progenitor cell decreased amount, abnormal	AB + MO1-tet2	Fig. 9 from Ge et al., 2014
polychromatophilic erythroblast increased amount, abnormal	AB + MO1-tet2	Fig. 9 from Ge et al., 2014
primitive hemopoiesis disrupted, abnormal	AB + MO1-tet2	Fig. 9 from Ge et al., 2014

Phenotype of all Fish created by or utilizing MO1-tet2

Phenotype	Fish	Conditions	Figures
intermediate cell mass of mesoderm erythroid progenitor cell decreased amount, abnormal	AB + MO1-tet2	standard conditions	Fig. 9 from Ge et al., 2014
primitive hemopoiesis disrupted, abnormal	AB + MO1-tet2	standard conditions	Fig. 9 from Ge et al., 2014
erythrocyte differentiation disrupted, abnormal	AB + MO1-tet2	standard conditions	Fig. 5, Fig. 9 from Ge et al., 2014
broad specificity oxidative DNA demethylase activity disrupted, abnormal	AB + MO1-tet2	standard conditions	Fig. 7 from Ge et al., 2014
polychromatophilic erythroblast increased amount, abnormal	AB + MO1-tet2	standard conditions	Fig. 9 from Ge et al., 2014
erythroid progenitor cell increased accumulation intermediate cell mass of mesoderm, abnormal	AB + MO1-tet2	standard conditions	Fig. 9 from Ge et al., 2014
axis structure, abnormal	AB/TU + MO1-tet1 + MO1-tet2 + MO1-tet3 + MO2-tet3	standard conditions	Fig. S17 from Bogdanović et al., 2016
head morphology, abnormal	AB/TU + MO1-tet1 + MO1-tet2 + MO1-tet3 + MO2-tet3	standard conditions	Fig. S17 from Bogdanović et al., 2016
regulation of DNA-templated transcription process quality, abnormal	AB/TU + MO1-tet1 + MO1-tet2 + MO1-tet3 + MO2-tet3	standard conditions	Fig. 5 from Bogdanović et al., 2016
chromatin organization process quality, abnormal	AB/TU + MO1-tet1 + MO1-tet2 + MO1-tet3 + MO2-tet3	standard conditions	Fig. 5 from Bogdanović et al., 2016
whole organism decreased pigmentation, abnormal	AB/TU + MO1-tet1 + MO1-tet2 + MO1-tet3 + MO2-tet3	standard conditions	Fig. S17 from Bogdanović et al., 2016
eye decreased size, abnormal	AB/TU + MO1-tet1 + MO1-tet2 + MO1-tet3 + MO2-tet3	standard conditions	Fig. S17 from Bogdanović et al., 2016
whole organism dead, abnormal	AB/TU + MO1-tet1 + MO1-tet2 + MO1-tet3 + MO2-tet3	standard conditions	Fig. S17 from Bogdanović et al., 2016
whole organism decreased length, abnormal	AB/TU + MO1-tet1 + MO1-tet2 + MO1-tet3 + MO2-tet3	standard conditions	Fig. S17 from Bogdanović et al., 2016
chromosomal 5-methylcytosine DNA demethylation pathway decreased process quality, abnormal	AB/TU + MO1-tet1 + MO1-tet2 + MO1-tet3 + MO2-tet3	standard conditions	Fig. 5 from Bogdanović et al., 2016

Citations