Morpholino

MO1-tet2

ID
ZDB-MRPHLNO-140402-10
Name
MO1-tet2
Previous Names
  • zTET2 MO (1)
Target
Sequence
5' - ATTGCTGGTCTTTTCTGTTTCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tet2
Phenotype
Phenotype resulting from MO1-tet2
Phenotype of all Fish created by or utilizing MO1-tet2
Phenotype Fish Conditions Figures
intermediate cell mass of mesoderm erythroid progenitor cell decreased amount, abnormal AB + MO1-tet2 standard conditions Fig. 9 from Ge et al., 2014
primitive hemopoiesis disrupted, abnormal AB + MO1-tet2 standard conditions Fig. 9 from Ge et al., 2014
erythrocyte differentiation disrupted, abnormal AB + MO1-tet2 standard conditions Fig. 5Fig. 9 from Ge et al., 2014
broad specificity oxidative DNA demethylase activity disrupted, abnormal AB + MO1-tet2 standard conditions Fig. 7 from Ge et al., 2014
polychromatophilic erythroblast increased amount, abnormal AB + MO1-tet2 standard conditions Fig. 9 from Ge et al., 2014
erythroid progenitor cell increased accumulation intermediate cell mass of mesoderm, abnormal AB + MO1-tet2 standard conditions Fig. 9 from Ge et al., 2014
axis structure, abnormal AB/TU + MO1-tet1 + MO1-tet2 + MO1-tet3 + MO2-tet3 standard conditions Fig. S17 from Bogdanovi? et al., 2016
head morphology, abnormal AB/TU + MO1-tet1 + MO1-tet2 + MO1-tet3 + MO2-tet3 standard conditions Fig. S17 from Bogdanovi? et al., 2016
regulation of DNA-templated transcription process quality, abnormal AB/TU + MO1-tet1 + MO1-tet2 + MO1-tet3 + MO2-tet3 standard conditions Fig. 5 from Bogdanovi? et al., 2016
chromatin organization process quality, abnormal AB/TU + MO1-tet1 + MO1-tet2 + MO1-tet3 + MO2-tet3 standard conditions Fig. 5 from Bogdanovi? et al., 2016
whole organism decreased pigmentation, abnormal AB/TU + MO1-tet1 + MO1-tet2 + MO1-tet3 + MO2-tet3 standard conditions Fig. S17 from Bogdanovi? et al., 2016
eye decreased size, abnormal AB/TU + MO1-tet1 + MO1-tet2 + MO1-tet3 + MO2-tet3 standard conditions Fig. S17 from Bogdanovi? et al., 2016
whole organism dead, abnormal AB/TU + MO1-tet1 + MO1-tet2 + MO1-tet3 + MO2-tet3 standard conditions Fig. S17 from Bogdanovi? et al., 2016
whole organism decreased length, abnormal AB/TU + MO1-tet1 + MO1-tet2 + MO1-tet3 + MO2-tet3 standard conditions Fig. S17 from Bogdanovi? et al., 2016
chromosomal 5-methylcytosine DNA demethylation pathway decreased process quality, abnormal AB/TU + MO1-tet1 + MO1-tet2 + MO1-tet3 + MO2-tet3 standard conditions Fig. 5 from Bogdanovi? et al., 2016
Citations