Morpholino
MO2-stac3
- ID
- ZDB-MRPHLNO-140311-3
- Name
- MO2-stac3
- Previous Names
- None
- Target
- Sequence
-
5' - TCATATTGAGCCATCAGTCCAGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-stac3
No data available
Phenotype
Phenotype resulting from MO2-stac3
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO2-stac3
1 - 5 of 8 Show all
Citations
- Linsley, J.W., Hsu, I.U., Groom, L., Yarotskyy, V., Lavorato, M., Horstick, E.J., Linsley, D., Wang, W., Franzini-Armstrong, C., Dirksen, R.T., Kuwada, J.Y. (2017) Congenital myopathy results from misregulation of a muscle Ca2+ channel by mutant Stac3. Proceedings of the National Academy of Sciences of the United States of America. 114(2):E228-E236
- Horstick, E.J., Linsley, J.W., Dowling, J.J., Hauser, M.A., McDonald, K.K., Ashley-Koch, A., Saint-Amant, L., Satish, A., Cui, W.W., Zhou, W., Sprague, S.M., Stamm, D.S., Powell, C.M., Speer, M.C., Franzini-Armstrong, C., Hirata, H., and Kuwada, J.Y. (2013) Stac3 is a component of the excitation-contraction coupling machinery and mutated in Native American myopathy. Nature communications. 4:1952
1 - 2 of 2
Show