header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-140310-12
Morpholino Name: MO2-pdgfra
Target: pdgfra (1)
Previous Name: pdgfra spl MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTCGAGACATCTGCAAGGAGATATT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-pdgfra No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-pdgfra No data available
PHENOTYPE
Phenotype resulting from MO2-pdgfra
No data available

Phenotype of all Fish created by or utilizing MO2-pdgfra
OTHER MO2-pdgfra MORPHOLINO PAGESNo links to external sites
CITATIONS (2)