Morpholino

MO1-pdgfra

ID
ZDB-MRPHLNO-140310-11
Name
MO1-pdgfra
Previous Names
  • pdgfra ATG MO (1)
Target
Sequence
5' - ATGGTCACGTAGATTGTGCTCAGCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pdgfra
Expressed Gene Anatomy Figures
cdh5 Fig. 4 from Damm et al., 2017
crestin Fig. 2,  Fig. 3 from Damm et al., 2017
efnb2a Fig. 4 from Damm et al., 2017
gata1a Fig. 4 from Damm et al., 2017
gata2b Fig. 4 from Damm et al., 2017
myb Fig. 3 from Damm et al., 2017
notch1b Fig. 4 from Damm et al., 2017
rag1 Fig. 3 from Damm et al., 2017
runx1 Fig. 3 from Damm et al., 2017
tal1 Fig. 4 from Damm et al., 2017
Phenotype
Phenotype resulting from MO1-pdgfra
Phenotype Fish Figures
hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal WIK + MO1-pdgfra Fig. 3 from Damm et al., 2017
hematopoietic multipotent progenitor cell decreased amount, abnormal WIK + MO1-pdgfra Fig. 3 from Damm et al., 2017
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal WIK + MO1-pdgfra Fig. 3 from Damm et al., 2017
hematopoietic progenitor cell differentiation decreased occurrence, abnormal WIK + MO1-pdgfra Fig. 3 from Damm et al., 2017
neural crest separated from dorsal aorta, abnormal vu234Tg; y1Tg + MO1-pdgfra Fig. 2 from Damm et al., 2017
T cell decreased amount, abnormal WIK + MO1-pdgfra Fig. 3 from Damm et al., 2017
thymus rag1 expression decreased amount, abnormal WIK + MO1-pdgfra Fig. 3 from Damm et al., 2017
trunk neural crest cell migration arrested, abnormal WIK + MO1-pdgfra Fig. 2,  Fig. 3 from Damm et al., 2017
Phenotype of all Fish created by or utilizing MO1-pdgfra
Phenotype Fish Conditions Figures
thymus rag1 expression decreased amount, abnormal WIK + MO1-pdgfra control Fig. 3 from Damm et al., 2017
T cell decreased amount, abnormal WIK + MO1-pdgfra control Fig. 3 from Damm et al., 2017
hematopoietic progenitor cell differentiation decreased occurrence, abnormal WIK + MO1-pdgfra control Fig. 3 from Damm et al., 2017
hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal WIK + MO1-pdgfra control Fig. 3 from Damm et al., 2017
hematopoietic multipotent progenitor cell decreased amount, abnormal WIK + MO1-pdgfra control Fig. 3 from Damm et al., 2017
trunk neural crest cell migration arrested, abnormal WIK + MO1-pdgfra control Fig. 2,  Fig. 3 from Damm et al., 2017
neural crest separated from dorsal aorta, abnormal WIK + MO1-pdgfra control Fig. 2 from Damm et al., 2017
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal WIK + MO1-pdgfra control Fig. 3 from Damm et al., 2017
trunk neural crest cell migration arrested, abnormal vu234Tg; y1Tg + MO1-pdgfra control Fig. 2 from Damm et al., 2017
neural crest separated from dorsal aorta, abnormal vu234Tg; y1Tg + MO1-pdgfra control Fig. 2 from Damm et al., 2017
hematopoietic stem cell decreased amount, abnormal s896Tg; zf169Tg + MO1-pdgfra control Fig. 3 from Damm et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.