Morpholino

MO2-piezo1

ID

ZDB-MRPHLNO-140227-1

Name

MO2-piezo1

Previous Names

Pz1 MO1 (1)

Target

piezo1 (1)

Sequence

5' - ATCCGCATACCACCTGAAGCTCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-piezo1

No data available

Phenotype

Phenotype resulting from MO2-piezo1

Phenotype	Fish	Figures
common cardinal vein nucleate erythrocyte decreased amount, abnormal	WT + MO2-piezo1	Fig. 1 from Faucherre et al., 2014
dorsal aorta nucleate erythrocyte decreased amount, abnormal	WT + MO2-piezo1	Fig. 1 from Faucherre et al., 2014
erythrocyte homeostasis disrupted, abnormal	WT + MO2-piezo1	Fig. 1 from Faucherre et al., 2014
nucleate erythrocyte decreased amount, abnormal	la2Tg + MO2-piezo1	Fig. S5 from Faucherre et al., 2014
nucleate erythrocyte deformed, abnormal	WT + MO2-piezo1	Fig. 4 from Faucherre et al., 2014
nucleate erythrocyte increased volume, abnormal	zf73Tg + MO2-piezo1	Fig. 3 from Faucherre et al., 2014
nucleate erythrocyte morphology, abnormal	zf73Tg + MO2-piezo1	Fig. 3 from Faucherre et al., 2014
nucleate erythrocyte spherical, abnormal	zf73Tg + MO2-piezo1	Fig. 3 from Faucherre et al., 2014
nucleate erythrocyte microtubule disorganized, abnormal	zf73Tg + MO2-piezo1	Fig. 4 from Faucherre et al., 2014
nucleate erythrocyte nucleus swollen, abnormal	WT + MO2-piezo1	Fig. 4 from Faucherre et al., 2014
nucleate erythrocyte plasma membrane broken, abnormal	WT + MO2-piezo1	Fig. 4 from Faucherre et al., 2014
nucleate erythrocyte plasma membrane deformed, abnormal	zf73Tg + MO2-piezo1	Fig. 3, Fig. 4 from Faucherre et al., 2014

Phenotype of all Fish created by or utilizing MO2-piezo1

Phenotype	Fish	Conditions	Figures
nucleate erythrocyte nucleus swollen, abnormal	WT + MO2-piezo1	standard conditions	Fig. 4 from Faucherre et al., 2014
nucleate erythrocyte plasma membrane broken, abnormal	WT + MO2-piezo1	standard conditions	Fig. 4 from Faucherre et al., 2014
nucleate erythrocyte plasma membrane deformed, abnormal	WT + MO2-piezo1	standard conditions	Fig. 4 from Faucherre et al., 2014
nucleate erythrocyte deformed, abnormal	WT + MO2-piezo1	standard conditions	Fig. 4 from Faucherre et al., 2014
dorsal aorta nucleate erythrocyte decreased amount, abnormal	WT + MO2-piezo1	standard conditions	Fig. 1 from Faucherre et al., 2014
erythrocyte homeostasis disrupted, abnormal	WT + MO2-piezo1	standard conditions	Fig. 1 from Faucherre et al., 2014
common cardinal vein nucleate erythrocyte decreased amount, abnormal	WT + MO2-piezo1	standard conditions	Fig. 1 from Faucherre et al., 2014
erythrocyte homeostasis disrupted, abnormal	WT + MO2-piezo1 + MO3-piezo1	standard conditions	Fig. S4 from Faucherre et al., 2014
nucleate erythrocyte decreased amount, abnormal	la2Tg + MO2-piezo1	standard conditions	Fig. S5 from Faucherre et al., 2014
nucleate erythrocyte increased volume, abnormal	zf73Tg + MO2-piezo1	standard conditions	Fig. 3 from Faucherre et al., 2014
nucleate erythrocyte plasma membrane deformed, abnormal	zf73Tg + MO2-piezo1	standard conditions	Fig. 3 from Faucherre et al., 2014
nucleate erythrocyte microtubule disorganized, abnormal	zf73Tg + MO2-piezo1	standard conditions	Fig. 4 from Faucherre et al., 2014
nucleate erythrocyte morphology, abnormal	zf73Tg + MO2-piezo1	standard conditions	Fig. 3 from Faucherre et al., 2014
nucleate erythrocyte spherical, abnormal	zf73Tg + MO2-piezo1	standard conditions	Fig. 3 from Faucherre et al., 2014

Citations