Morpholino
MO3-ift172
- ID
- ZDB-MRPHLNO-140131-1
- Name
- MO3-ift172
- Previous Names
-
- ift172 Exon1 splice blocking MO (1)
- Target
- Sequence
-
5' - ACGTCGTCAATATTTTACCTGAGGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-ift172
No data available
Phenotype
Phenotype resulting from MO3-ift172
Phenotype | Fish | Figures |
---|---|---|
caudal fin curved, abnormal | li1Tg + MO3-ift172 |
Fig. 1 ![]() ![]() |
pericardium edematous, abnormal | li1Tg + MO3-ift172 |
Fig. 1 ![]() ![]() |
pronephros cystic, abnormal | li1Tg + MO3-ift172 |
Fig. 1 ![]() ![]() |
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO3-ift172
1 - 5 of 6 Show all
Citations
- Pandey, G., Westhoff, J.H., Schaefer, F., Gehrig, J. (2019) A Smart Imaging Workflow for Organ-Specific Screening in a Cystic Kidney Zebrafish Disease Model. International Journal of Molecular Sciences. 20(6)
- Halbritter, J., Bizet, A.A., Schmidts, M., Porath, J.D., Braun, D.A., Gee, H.Y., McInerney-Leo, A.M., Krug, P., Filhol, E., Davis, E.E., Airik, R., Czarnecki, P.G., Lehman, A.M., Trnka, P., Nitschké, P., Bole-Feysot, C., Schueler, M., Knebelmann, B., Burtey, S., Szabó, A.J., Tory, K., Leo, P.J., Gardiner, B., McKenzie, F.A., Zankl, A., Brown, M.A., Hartley, J.L., Maher, E.R., Li, C., Leroux, M.R., Scambler, P.J., Zhan, S.H., Jones, S.J., Kayserili, H., Tuysuz, B., Moorani, K.N., Constantinescu, A., Krantz, I.D., Kaplan, B.S., Shah, J.V., Hurd, T.W., Doherty, D., Katsanis, N., Duncan, E.L., Otto, E.A., Beales, P.L., Mitchison, H.M., Saunier, S., and Hildebrandt, F. (2013) Defects in the IFT-B Component IFT172 Cause Jeune and Mainzer-Saldino Syndromes in Humans. American journal of human genetics. 93(5):915-925
- Westhoff, J.H., Giselbrecht, S., Schmidts, M., Schindler, S., Beales, P.L., Tönshoff, B., Liebel, U., and Gehrig, J. (2013) Development of an Automated Imaging Pipeline for the Analysis of the Zebrafish Larval Kidney. PLoS One. 8(12):e82137
1 - 3 of 3
Show