Morpholino

MO2-col22a1

ID

ZDB-MRPHLNO-140115-7

Name

MO2-col22a1

Previous Names

MO22b (1)

Target

col22a1 (1)

Sequence

5' - CCTGAGCCCAAATCGAAACTCCATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-col22a1

Expressed Gene	Anatomy	Figures
col12a1a	myotome vertical myoseptum	Fig. 5 from Charvet et al., 2013

Phenotype

Phenotype resulting from MO2-col22a1

Phenotype	Fish	Figures
muscle attachment decreased process quality, abnormal	AB/TU + MO2-col22a1	Fig. 3 , Fig. 4 , Fig. 5 from Charvet et al., 2013
myotome dystrophic, abnormal	AB/TU + MO2-col22a1	Fig. 2 from Charvet et al., 2013
myotome U-shaped, abnormal	AB/TU + MO2-col22a1	Fig. 2 from Charvet et al., 2013
myotome muscle tendon junction malformed, abnormal	AB/TU + MO2-col22a1	Fig. 3 , Fig. 4 , Fig. 5 from Charvet et al., 2013
myotome skeletal muscle cell disorganized, abnormal	AB/TU + MO2-col22a1	Fig. 2 from Charvet et al., 2013
post-vent region curved ventral, abnormal	AB/TU + MO2-col22a1	Fig. 2 from Charvet et al., 2013
skeletal muscle cell detached from vertical myoseptum, abnormal	AB/TU + MO2-col22a1	Fig. 3 from Charvet et al., 2013
skeletal muscle contraction decreased force, abnormal	AB/TU + MO2-col22a1	Fig. 3 from Charvet et al., 2013
skeletal muscle tissue development decreased process quality, abnormal	AB/TU + MO2-col22a1	Fig. 2 from Charvet et al., 2013
trunk curved ventral, abnormal	AB/TU + MO2-col22a1	Fig. 2 from Charvet et al., 2013
vertical myoseptum fibroblast mislocalised, abnormal	AB/TU + MO2-col22a1	Fig. 4 from Charvet et al., 2013

Phenotype of all Fish created by or utilizing MO2-col22a1

Phenotype	Fish	Conditions	Figures
myotome U-shaped, abnormal	AB/TU + MO2-col22a1	standard conditions	Fig. 2 from Charvet et al., 2013
vertical myoseptum fibroblast mislocalised, abnormal	AB/TU + MO2-col22a1	standard conditions	Fig. 4 from Charvet et al., 2013
skeletal muscle contraction decreased force, abnormal	AB/TU + MO2-col22a1	standard conditions	Fig. 3 from Charvet et al., 2013
myotome dystrophic, abnormal	AB/TU + MO2-col22a1	standard conditions	Fig. 2 from Charvet et al., 2013
skeletal muscle tissue development decreased process quality, abnormal	AB/TU + MO2-col22a1	standard conditions	Fig. 2 from Charvet et al., 2013
skeletal muscle cell detached from vertical myoseptum, abnormal	AB/TU + MO2-col22a1	standard conditions	Fig. 3 from Charvet et al., 2013
myotome skeletal muscle cell disorganized, abnormal	AB/TU + MO2-col22a1	standard conditions	Fig. 2 from Charvet et al., 2013
myotome muscle tendon junction malformed, abnormal	AB/TU + MO2-col22a1	standard conditions	Fig. 3 , Fig. 4 , Fig. 5 from Charvet et al., 2013
post-vent region curved ventral, abnormal	AB/TU + MO2-col22a1	standard conditions	Fig. 2 from Charvet et al., 2013
muscle attachment decreased process quality, abnormal	AB/TU + MO2-col22a1	standard conditions	Fig. 3 , Fig. 4 , Fig. 5 from Charvet et al., 2013
trunk curved ventral, abnormal	AB/TU + MO2-col22a1	standard conditions	Fig. 2 from Charvet et al., 2013
muscle attachment decreased process quality, abnormal	AB/TU + MO1-itga7 + MO2-col22a1	standard conditions	Fig. 6 from Charvet et al., 2013
skeletal muscle cell detached from vertical myoseptum, abnormal	AB/TU + MO1-itga7 + MO2-col22a1	standard conditions	Fig. 6 from Charvet et al., 2013

Citations