header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-131230-2
Morpholino Name: MO3-otx2b
Target: otx2b (1)
Previous Names: MO3-otx2, otx2-SB (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGAGTTGAAAGATGCGTACCTGTAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-otx2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-otx2b No data available
PHENOTYPE
Phenotype resulting from MO3-otx2b
Phenotype of all Fish created by or utilizing MO3-otx2b
Phenotype Fish Conditions Figures
ceratobranchial cartilage shortened, abnormal WT + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
eye decreased size, abnormal WT + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
ceratobranchial cartilage curved, abnormal WT + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
mandibular arch skeleton shortened, abnormal WT + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
ceratohyal cartilage orientation axis, abnormal WT + MO1-pgap1 + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
pharyngeal arch cartilage disorganized, abnormal WT + MO1-pgap1 + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
ceratobranchial cartilage shortened, abnormal WT + MO1-pgap1 + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
eye decreased size, abnormal WT + MO1-pgap1 + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
ceratobranchial cartilage curved, abnormal WT + MO1-pgap1 + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
chondrocranium cartilage malformed, abnormal WT + MO1-pgap1 + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
Meckel's cartilage shape, abnormal WT + MO1-pgap1 + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
eye fused with eye, abnormal WT + MO1-pgap1 + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
pharyngeal arch cartilage malformed, abnormal WT + MO1-pgap1 + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
eye decreased size, abnormal WT + MO2-msx1a + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
ceratobranchial cartilage shortened, abnormal WT + MO2-msx1a + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
ceratobranchial cartilage curved, abnormal WT + MO2-msx1a + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
chondrocranium cartilage malformed, abnormal WT + MO2-msx1a + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
pharyngeal arch cartilage malformed, abnormal WT + MO2-msx1a + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
pharyngeal arch cartilage malformed, abnormal WT + MO1-prrx1a + MO1-prrx1b + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
eye decreased size, abnormal WT + MO1-prrx1a + MO1-prrx1b + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
ceratobranchial cartilage curved, abnormal WT + MO1-prrx1a + MO1-prrx1b + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
ceratobranchial cartilage shortened, abnormal WT + MO1-prrx1a + MO1-prrx1b + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
chondrocranium cartilage malformed, abnormal WT + MO1-prrx1a + MO1-prrx1b + MO3-otx2b standard conditions Fig. 3 from Chassaing et al., 2012
OTHER MO3-otx2b MORPHOLINO PAGESNo links to external sites
CITATIONS (1)