Morpholino

MO1-dis3l2

ID
ZDB-MRPHLNO-131220-1
Name
MO1-dis3l2
Previous Names
  • Zfdis3l2-ATG MO (1)
Target
Sequence
5' - ATGCCATAATCTCGTCTACAGTTAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dis3l2
No data available
Phenotype
Phenotype resulting from MO1-dis3l2
Phenotype Fish Figures
blastomere metaphase chromosome alignment decreased process quality, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
blastomere mitotic nuclear bridge increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
blastomere mitotic spindle elongated, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
blastomere mitotic spindle ab3-tuba labeling spatial pattern, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
blastomere spindle pole distributed, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
blastomere spindle pole Ab8-tubg1 labeling spatial pattern, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
brain anatomical structure quality, abnormal AB/TU + MO1-dis3l2 Fig. 1 with image,  Fig. 3 with image from D'Silva et al., 2025
brain deformed, abnormal AB/TU + MO1-dis3l2 Fig. 1 with image,  Fig. 3 with image from D'Silva et al., 2025
brain apoptotic process increased process quality, abnormal AB/TU + MO1-dis3l2 Fig. 3 with image from D'Silva et al., 2025
cloaca development disrupted, abnormal WT + MO1-dis3l2 Fig. S11 from Astuti et al., 2012
cranial cartilage morphology, abnormal AB/TU + MO1-dis3l2 Fig. 1 with image from D'Silva et al., 2025
cranial neural crest twist1a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 Fig. 2 with image from D'Silva et al., 2025
cranial neural crest foxd3 expression decreased distribution, abnormal AB/TU + MO1-dis3l2 Fig. 2 with image from D'Silva et al., 2025
eye pax2a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 Fig. 2 with image from D'Silva et al., 2025
eye fgf8a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 Fig. 2 with image from D'Silva et al., 2025
eye deformed, abnormal AB/TU + MO1-dis3l2 Fig. 1 with image,  Fig. 3 with image from D'Silva et al., 2025
forebrain anatomical structure quality, abnormal AB/TU + MO1-dis3l2 Fig. 1 with image,  Fig. 3 with image from D'Silva et al., 2025
forebrain undulate, abnormal AB/TU + MO1-dis3l2 Fig. 1 with image,  Fig. 3 with image from D'Silva et al., 2025
head decreased area, abnormal AB/TU + MO1-dis3l2 Fig. 3 with image from D'Silva et al., 2025
hindbrain anatomical structure quality, abnormal AB/TU + MO1-dis3l2 Fig. 1 with image,  Fig. 3 with image from D'Silva et al., 2025
midbrain anatomical structure quality, abnormal AB/TU + MO1-dis3l2 Fig. 1 with image,  Fig. 3 with image from D'Silva et al., 2025
midbrain hindbrain boundary absence of anatomical entity, abnormal AB/TU + MO1-dis3l2 Fig. 1 with image,  Fig. 3 with image from D'Silva et al., 2025
midbrain hindbrain boundary pax2a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 Fig. 2 with image from D'Silva et al., 2025
midbrain hindbrain boundary fgf8a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 Fig. 2 with image from D'Silva et al., 2025
neural crest sox10 expression decreased distribution, abnormal AB/TU + MO1-dis3l2 Fig. 2 with image from D'Silva et al., 2025
neural tube apoptotic process increased process quality, abnormal AB/TU + MO1-dis3l2 Fig. 3 with image from D'Silva et al., 2025
optic stalk pax2a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 Fig. 2 with image from D'Silva et al., 2025
otic vesicle pax2a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 Fig. 2 with image from D'Silva et al., 2025
pericardium edematous, abnormal AB/TU + MO1-dis3l2 Fig. 1 with image from D'Silva et al., 2025
Fig. S11 from Astuti et al., 2012
pronephric duct opening morphology, abnormal WT + MO1-dis3l2 Fig. S11 from Astuti et al., 2012
pronephros development disrupted, abnormal WT + MO1-dis3l2 Fig. S11 from Astuti et al., 2012
trunk neural crest crestin expression increased distribution, abnormal AB/TU + MO1-dis3l2 Fig. 2 with image from D'Silva et al., 2025
whole organism ab3-gsk3b labeling decreased amount, abnormal AB/TU + MO1-dis3l2 Fig. 3 with image from D'Silva et al., 2025
whole organism Ab3-mek1 labeling decreased amount, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
whole organism Ab1-dis3l2 labeling decreased amount, abnormal AB/TU + MO1-dis3l2 Fig. 1 with image from D'Silva et al., 2025
whole organism ab10-akt labeling increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 3 with image from D'Silva et al., 2025
whole organism Ab3-casp9 labeling increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 3 with image from D'Silva et al., 2025
whole organism cdkn1bb expression increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
whole organism Ab15-casp3 labeling increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 3 with image from D'Silva et al., 2025
whole organism cdkn1ba expression increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
whole organism foxo3a expression increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 3 with image from D'Silva et al., 2025
whole organism ccnd1 expression increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
whole organism Ab3-cdk1 labeling increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
whole organism cdkn1a expression increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 4 with image from D'Silva et al., 2025
whole organism bbc3 expression increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 3 with image from D'Silva et al., 2025
whole organism bcl2l11 expression increased amount, abnormal AB/TU + MO1-dis3l2 Fig. 3 with image from D'Silva et al., 2025
whole organism viability, abnormal AB/TU + MO1-dis3l2 Fig. 1 with image from D'Silva et al., 2025
Phenotype of all Fish created by or utilizing MO1-dis3l2
Phenotype Fish Conditions Figures
midbrain hindbrain boundary morphology, ameliorated AB/TU + MO1-dis3l2 chemical treatment by environment: SC79 Fig. 3 with image from D'Silva et al., 2025
cranial neural crest twist1a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 control Fig. 2 with image from D'Silva et al., 2025
whole organism bcl2l11 expression increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 3 with image from D'Silva et al., 2025
brain apoptotic process process quality, ameliorated AB/TU + MO1-dis3l2 chemical treatment by environment: SC79 Fig. 3 with image from D'Silva et al., 2025
midbrain hindbrain boundary absence of anatomical entity, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with image,  Fig. 3 with image from D'Silva et al., 2025
cranial cartilage morphology, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with image from D'Silva et al., 2025
brain deformed, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with image,  Fig. 3 with image from D'Silva et al., 2025
midbrain hindbrain boundary pax2a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 control Fig. 2 with image from D'Silva et al., 2025
whole organism viability, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with image from D'Silva et al., 2025
blastomere mitotic spindle ab3-tuba labeling spatial pattern, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
cranial neural crest foxd3 expression decreased distribution, abnormal AB/TU + MO1-dis3l2 control Fig. 2 with image from D'Silva et al., 2025
blastomere spindle pole Ab8-tubg1 labeling spatial pattern, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
brain anatomical structure quality, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with image,  Fig. 3 with image from D'Silva et al., 2025
eye deformed, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with image,  Fig. 3 with image from D'Silva et al., 2025
midbrain morphology, ameliorated AB/TU + MO1-dis3l2 chemical treatment by environment: SC79 Fig. 3 with image from D'Silva et al., 2025
blastomere mitotic nuclear bridge increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
eye morphology, ameliorated AB/TU + MO1-dis3l2 chemical treatment by environment: SC79 Fig. 3 with image from D'Silva et al., 2025
whole organism Ab3-cdk1 labeling increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
otic vesicle pax2a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 control Fig. 2 with image from D'Silva et al., 2025
whole organism cdkn1ba expression increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
whole organism cdkn1a expression increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
neural tube apoptotic process increased process quality, abnormal AB/TU + MO1-dis3l2 control Fig. 3 with image from D'Silva et al., 2025
hindbrain anatomical structure quality, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with image,  Fig. 3 with image from D'Silva et al., 2025
forebrain morphology, ameliorated AB/TU + MO1-dis3l2 chemical treatment by environment: SC79 Fig. 3 with image from D'Silva et al., 2025
brain morphology, ameliorated AB/TU + MO1-dis3l2 chemical treatment by environment: SC79 Fig. 3 with image from D'Silva et al., 2025
brain apoptotic process increased process quality, abnormal AB/TU + MO1-dis3l2 control Fig. 3 with image from D'Silva et al., 2025
whole organism Ab15-casp3 labeling increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 3 with image from D'Silva et al., 2025
neural tube apoptotic process process quality, ameliorated AB/TU + MO1-dis3l2 chemical treatment by environment: SC79 Fig. 3 with image from D'Silva et al., 2025
pericardium edematous, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with image from D'Silva et al., 2025
blastomere spindle pole distributed, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
neural crest sox10 expression decreased distribution, abnormal AB/TU + MO1-dis3l2 control Fig. 2 with image from D'Silva et al., 2025
forebrain anatomical structure quality, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with image,  Fig. 3 with image from D'Silva et al., 2025
whole organism foxo3a expression increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 3 with image from D'Silva et al., 2025
whole organism ab10-akt labeling increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 3 with image from D'Silva et al., 2025
whole organism ccnd1 expression increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
whole organism cdkn1bb expression increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
whole organism Ab1-dis3l2 labeling decreased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with image from D'Silva et al., 2025
eye pax2a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 control Fig. 2 with image from D'Silva et al., 2025
optic stalk pax2a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 control Fig. 2 with image from D'Silva et al., 2025
head decreased area, abnormal AB/TU + MO1-dis3l2 control Fig. 3 with image from D'Silva et al., 2025
forebrain undulate, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with image,  Fig. 3 with image from D'Silva et al., 2025
whole organism bbc3 expression increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 3 with image from D'Silva et al., 2025
midbrain hindbrain boundary fgf8a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 control Fig. 2 with image from D'Silva et al., 2025
whole organism Ab3-mek1 labeling decreased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
whole organism Ab3-casp9 labeling increased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 3 with image from D'Silva et al., 2025
blastomere metaphase chromosome alignment decreased process quality, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
trunk neural crest crestin expression increased distribution, abnormal AB/TU + MO1-dis3l2 control Fig. 2 with image from D'Silva et al., 2025
eye fgf8a expression decreased distribution, abnormal AB/TU + MO1-dis3l2 control Fig. 2 with image from D'Silva et al., 2025
whole organism ab3-gsk3b labeling decreased amount, abnormal AB/TU + MO1-dis3l2 control Fig. 3 with image from D'Silva et al., 2025
midbrain anatomical structure quality, abnormal AB/TU + MO1-dis3l2 control Fig. 1 with image,  Fig. 3 with image from D'Silva et al., 2025
hindbrain morphology, ameliorated AB/TU + MO1-dis3l2 chemical treatment by environment: SC79 Fig. 3 with image from D'Silva et al., 2025
blastomere mitotic spindle elongated, abnormal AB/TU + MO1-dis3l2 control Fig. 4 with image from D'Silva et al., 2025
pronephros development disrupted, abnormal WT + MO1-dis3l2 standard conditions Fig. S11 from Astuti et al., 2012
pronephric duct opening morphology, abnormal WT + MO1-dis3l2 standard conditions Fig. S11 from Astuti et al., 2012
cloaca development disrupted, abnormal WT + MO1-dis3l2 standard conditions Fig. S11 from Astuti et al., 2012
pericardium edematous, abnormal WT + MO1-dis3l2 standard conditions Fig. S11 from Astuti et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.