Morpholino
MO3-chd7
- ID
- ZDB-MRPHLNO-131211-1
- Name
- MO3-chd7
- Previous Names
- None
- Target
- Sequence
-
5' - ACCTACAATGAAGGAAATAGGCCGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-chd7
No data available
Phenotype
Phenotype resulting from MO3-chd7
1 - 5 of 19 Show all
Phenotype of all Fish created by or utilizing MO3-chd7
1 - 5 of 61 Show all
Citations
- Asad, Z., Sachidanandan, C. (2019) Chemical screens in a zebrafish model of CHARGE syndrome identifies small molecules that ameliorates disease like phenotypes in embryo. European Journal of Medical Genetics. 63(2):103661
- Cloney, K., Steele, S.L., Stoyek, M.R., Croll, R.P., Smith, F.M., Prykhozhij, S.V., Brown, M.M., Midgen, C., Blake, K., Berman, J.N. (2018) Etiology and functional validation of gastrointestinal motility dysfunction in a zebrafish model of CHARGE syndrome. The FEBS journal. 285(11):2125-2140
- Asad, Z., Pandey, A., Babu, A., Sun, Y., Shevade, K., Kapoor, S., Ullah, I., Ranjan, S., Scaria, V., Bajpai, R., Sachidanandan, C. (2016) Rescue of neural crest derived phenotypes in a zebrafish CHARGE model by sox10 downregulation. Human molecular genetics. 25(16):3539-3554
- Balow, S.A., Pierce, L.X., Zentner, G.E., Conrad, P.A., Davis, S., Sabaawy, H.E., McDermott, B.M., and Scacheri, P.C. (2013) Knockdown of fbxl10/kdm2bb rescues chd7 morphant phenotype in a zebrafish model of CHARGE syndrome. Developmental Biology. 382(1):57-69
1 - 4 of 4
Show