Morpholino

MO3-chd7

ID
ZDB-MRPHLNO-131211-1
Name
MO3-chd7
Previous Names
None
Target
Sequence
5' - ACCTACAATGAAGGAAATAGGCCGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-chd7
Expressed Gene Anatomy Figures
cdkn1a Fig. 4 with image from Balow et al., 2013
cdkn1bb Fig. 4 with image from Balow et al., 2013
cdkn2a/b Fig. 4 with image from Balow et al., 2013
crestin Fig. S5 from Asad et al., 2016
isl2a Fig. S5 from Asad et al., 2016
mbpa Fig. S6 from Asad et al., 2016
neurod1 Fig. S5 from Asad et al., 2016
Phenotype
Phenotype resulting from MO3-chd7
Phenotype Fish Figures
blood circulation disrupted, abnormal TU + MO3-chd7 Fig. 2 with image from Balow et al., 2013
cell population proliferation decreased occurrence, abnormal TU + MO3-chd7 Fig. 4 with image from Balow et al., 2013
ceratobranchial cartilage absent, abnormal TU + MO3-chd7 Fig. 3 with image,  Fig. S1 with image from Balow et al., 2013
ceratohyal cartilage malformed, abnormal TU + MO3-chd7 Fig. 3 with image from Balow et al., 2013
cranial cartilage morphology, abnormal TU + MO3-chd7 Fig. 3 with image,  Fig. S1 with image from Balow et al., 2013
cranial motor neuron isl2a expression decreased amount, abnormal TU + MO3-chd7 Fig. S5 from Asad et al., 2016
eye morphology, abnormal TU + MO3-chd7 Fig. 2 with image from Balow et al., 2013
head neuroblast neurod1 expression decreased amount, abnormal TU + MO3-chd7 Fig. S5 from Asad et al., 2016
heart contraction decreased process quality, abnormal TU + MO3-chd7 Fig. 2 with image from Balow et al., 2013
myelinating Schwann cell mbpa expression decreased amount, abnormal TU + MO3-chd7 Fig. S6 from Asad et al., 2016
myelinating Schwann cell mbpa expression decreased distribution, abnormal TU + MO3-chd7 Fig. S6 from Asad et al., 2016
neurocranium decreased size, abnormal TU + MO3-chd7 Fig. 3 with image,  Fig. S1 with image from Balow et al., 2013
otolith amount, abnormal TU + MO3-chd7 Fig. 2 with image from Balow et al., 2013
otolith morphology, abnormal TU + MO3-chd7 Fig. 2 with image from Balow et al., 2013
pectoral fin hypoplastic, abnormal TU + MO3-chd7 Fig. 2 with image from Balow et al., 2013
pericardium edematous, abnormal TU + MO3-chd7 Fig. 2 with image from Balow et al., 2013
pharyngeal arch 3-7 absent, abnormal TU + MO3-chd7 Fig. 3 with image from Balow et al., 2013
pharyngeal arch cartilage morphology, abnormal ba2Tg + MO3-chd7 Fig. S7 from Asad et al., 2016
vagal neural crest crestin expression decreased amount, abnormal TU + MO3-chd7 Fig. S5 from Asad et al., 2016
Phenotype of all Fish created by or utilizing MO3-chd7
Phenotype Fish Conditions Figures
pectoral fin hypoplastic, abnormal TU + MO3-chd7 standard conditions Fig. 2 with image from Balow et al., 2013
otolith amount, abnormal TU + MO3-chd7 standard conditions Fig. 2 with image from Balow et al., 2013
cranial motor neuron isl2a expression decreased amount, abnormal TU + MO3-chd7 standard conditions Fig. S5 from Asad et al., 2016
cranial cartilage morphology, abnormal TU + MO3-chd7 standard conditions Fig. 3 with image,  Fig. S1 with image from Balow et al., 2013
ceratohyal cartilage malformed, abnormal TU + MO3-chd7 standard conditions Fig. 3 with image from Balow et al., 2013
pericardium edematous, abnormal TU + MO3-chd7 standard conditions Fig. 2 with image from Balow et al., 2013
heart contraction decreased process quality, abnormal TU + MO3-chd7 standard conditions Fig. 2 with image from Balow et al., 2013
otolith morphology, abnormal TU + MO3-chd7 standard conditions Fig. 2 with image from Balow et al., 2013
eye morphology, abnormal TU + MO3-chd7 standard conditions Fig. 2 with image from Balow et al., 2013
myelinating Schwann cell mbpa expression decreased distribution, abnormal TU + MO3-chd7 standard conditions Fig. S6 from Asad et al., 2016
ceratobranchial cartilage absent, abnormal TU + MO3-chd7 standard conditions Fig. 3 with image,  Fig. S1 with image from Balow et al., 2013
neurocranium decreased size, abnormal TU + MO3-chd7 standard conditions Fig. 3 with image,  Fig. S1 with image from Balow et al., 2013
head neuroblast neurod1 expression decreased amount, abnormal TU + MO3-chd7 standard conditions Fig. S5 from Asad et al., 2016
vagal neural crest crestin expression decreased amount, abnormal TU + MO3-chd7 standard conditions Fig. S5 from Asad et al., 2016
myelinating Schwann cell mbpa expression decreased amount, abnormal TU + MO3-chd7 standard conditions Fig. S6 from Asad et al., 2016
pharyngeal arch 3-7 absent, abnormal TU + MO3-chd7 standard conditions Fig. 3 with image from Balow et al., 2013
blood circulation disrupted, abnormal TU + MO3-chd7 standard conditions Fig. 2 with image from Balow et al., 2013
cell population proliferation decreased occurrence, abnormal TU + MO3-chd7 standard conditions Fig. 4 with image from Balow et al., 2013
cranium motor neuron isl2a expression spatial pattern, ameliorated TU + MO3-chd7 + MO8-chd7 chemical treatment by environment: procainamide Fig. 4 from Asad et al., 2019
cranium sensory neuron isl2a expression spatial pattern, ameliorated TU + MO3-chd7 + MO8-chd7 chemical treatment by environment: CHIC-35 Fig. 4 from Asad et al., 2019
trunk foxd3 expression amount, ameliorated TU + MO3-chd7 + MO8-chd7 chemical treatment by environment: CHIC-35 Fig. 5 from Asad et al., 2019
perichondrium sox9b expression decreased amount, abnormal TU + MO3-chd7 + MO8-chd7 chemical treatment by environment: DAPT Fig. 3 from Asad et al., 2019
pharyngeal arch cartilage sox9a expression amount, ameliorated TU + MO3-chd7 + MO8-chd7 chemical treatment by environment: CHIC-35 Fig. 3 from Asad et al., 2019
lateral line glial cell mbpa expression amount, ameliorated TU + MO3-chd7 + MO8-chd7 chemical treatment by environment: procainamide Fig. 5 from Asad et al., 2019
cranium sensory neuron isl2a expression spatial pattern, abnormal TU + MO3-chd7 + MO8-chd7 standard conditions Fig. 1 from Asad et al., 2019
perichondrium sox9b expression decreased amount, abnormal TU + MO3-chd7 + MO8-chd7 standard conditions Fig. 1 from Asad et al., 2019
lateral line glial cell mbpa expression amount, ameliorated TU + MO3-chd7 + MO8-chd7 chemical treatment by environment: CHIC-35 Fig. 5 from Asad et al., 2019
pharyngeal arch cartilage sox9a expression amount, ameliorated TU + MO3-chd7 + MO8-chd7 chemical treatment by environment: procainamide Fig. 3 from Asad et al., 2019
pharyngeal arch cartilage sox9a expression decreased amount, abnormal TU + MO3-chd7 + MO8-chd7 standard conditions Fig. 1 from Asad et al., 2019
cranium sensory neuron isl2a expression spatial pattern, ameliorated TU + MO3-chd7 + MO8-chd7 chemical treatment by environment: procainamide Fig. 4 from Asad et al., 2019
trunk foxd3 expression amount, ameliorated TU + MO3-chd7 + MO8-chd7 chemical treatment by environment: 4-(dimethylamino)-N-[7-(hydroxyamino)-7-oxoheptyl]benzamide Fig. 5 from Asad et al., 2019
trunk foxd3 expression increased amount, abnormal TU + MO3-chd7 + MO8-chd7 standard conditions Fig. 5 from Asad et al., 2019
cranium motor neuron isl2a expression spatial pattern, abnormal TU + MO3-chd7 + MO8-chd7 standard conditions Fig. 1 from Asad et al., 2019
eye decreased size, abnormal TU + MO3-chd7 + MO8-chd7 standard conditions Fig. 1 from Asad et al., 2019
pericardium edematous, abnormal TU + MO3-chd7 + MO8-chd7 standard conditions Fig. 1 from Asad et al., 2019
lateral line glial cell mbpa expression amount, ameliorated TU + MO3-chd7 + MO8-chd7 chemical treatment by environment: 4-(dimethylamino)-N-[7-(hydroxyamino)-7-oxoheptyl]benzamide Fig. 5 from Asad et al., 2019
perichondrium sox9b expression decreased amount, abnormal TU + MO3-chd7 + MO8-chd7 chemical treatment by environment: 4-(dimethylamino)-N-[7-(hydroxyamino)-7-oxoheptyl]benzamide Fig. 3 from Asad et al., 2019
mandibular arch skeleton decreased size, abnormal TU + MO3-chd7 + MO8-chd7 standard conditions Fig. 1 from Asad et al., 2019
pharyngeal arch cartilage sox9a expression amount, ameliorated TU + MO3-chd7 + MO8-chd7 chemical treatment by environment: DAPT Fig. 3 from Asad et al., 2019
perichondrium sox9b expression decreased amount, abnormal TU + MO3-chd7 + MO8-chd7 chemical treatment by environment: CHIC-35 Fig. 3 from Asad et al., 2019
lateral line glial cell mbpa expression decreased amount, abnormal TU + MO3-chd7 + MO8-chd7 standard conditions Fig. 5 from Asad et al., 2019
cranium motor neuron isl2a expression spatial pattern, ameliorated TU + MO3-chd7 + MO8-chd7 chemical treatment by environment: CHIC-35 Fig. 4 from Asad et al., 2019
glial cell mbpa expression decreased amount, abnormal TU + MO3-chd7 + MO8-chd7 standard conditions Fig. 1 from Asad et al., 2019
trunk foxd3 expression amount, ameliorated TU + MO3-chd7 + MO8-chd7 chemical treatment by environment: DAPT Fig. 5 from Asad et al., 2019
pharyngeal arch cartilage sox9a expression amount, ameliorated TU + MO3-chd7 + MO8-chd7 chemical treatment by environment: 4-(dimethylamino)-N-[7-(hydroxyamino)-7-oxoheptyl]benzamide Fig. 3 from Asad et al., 2019
trunk foxd3 expression increased amount, abnormal TU + MO3-chd7 + MO8-chd7 chemical treatment by environment: procainamide Fig. 5 from Asad et al., 2019
lateral line glial cell mbpa expression amount, ameliorated TU + MO3-chd7 + MO8-chd7 chemical treatment by environment: DAPT Fig. 5 from Asad et al., 2019
perichondrium sox9b expression decreased amount, abnormal TU + MO3-chd7 + MO8-chd7 chemical treatment by environment: procainamide Fig. 3 from Asad et al., 2019
pharyngeal arch cartilage morphology, abnormal ba2Tg + MO3-chd7 standard conditions Fig. S7 from Asad et al., 2016
enteric neuron decreased amount, abnormal zf148Tg + MO3-chd7 + MO8-chd7 standard conditions Fig. 1 from Asad et al., 2019
mandibular arch skeleton decreased size, abnormal zf148Tg + MO3-chd7 + MO8-chd7 chemical treatment by environment: procainamide Fig. 3 from Asad et al., 2019
mandibular arch skeleton decreased size, abnormal zf148Tg + MO3-chd7 + MO8-chd7 chemical treatment by environment: DAPT Fig. 3 from Asad et al., 2019
pharyngeal arch cartilage morphology, ameliorated zf148Tg + MO3-chd7 + MO8-chd7 chemical treatment by environment: 4-(dimethylamino)-N-[7-(hydroxyamino)-7-oxoheptyl]benzamide Fig. 3 from Asad et al., 2019
enteric neuron decreased amount, abnormal zf148Tg + MO3-chd7 + MO8-chd7 chemical treatment by environment: CHIC-35 Fig. 4 from Asad et al., 2019
pharyngeal arch cartilage morphology, ameliorated zf148Tg + MO3-chd7 + MO8-chd7 chemical treatment by environment: CHIC-35 Fig. 3 from Asad et al., 2019
enteric neuron decreased amount, abnormal zf148Tg + MO3-chd7 + MO8-chd7 chemical treatment by environment: procainamide Fig. 4 from Asad et al., 2019
pharyngeal arch cartilage morphology, ameliorated zf148Tg + MO3-chd7 + MO8-chd7 chemical treatment by environment: procainamide Fig. 3 from Asad et al., 2019
mandibular arch skeleton decreased size, abnormal zf148Tg + MO3-chd7 + MO8-chd7 chemical treatment by environment: CHIC-35 Fig. 3 from Asad et al., 2019
mandibular arch skeleton decreased size, abnormal zf148Tg + MO3-chd7 + MO8-chd7 chemical treatment by environment: 4-(dimethylamino)-N-[7-(hydroxyamino)-7-oxoheptyl]benzamide Fig. 3 from Asad et al., 2019
pharyngeal arch cartilage morphology, ameliorated zf148Tg + MO3-chd7 + MO8-chd7 chemical treatment by environment: DAPT Fig. 3 from Asad et al., 2019
ceratohyal cartilage malformed, abnormal TU + MO1-kdm2bb + MO3-chd7 standard conditions Fig. 6 with image from Balow et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.