Morpholino

MO1-agtpbp1

ID
ZDB-MRPHLNO-131125-1
Name
MO1-agtpbp1
Previous Names
  • CCP1-MO1 (1)
Target
Sequence
5' - GGTGTTCTGTACGAAAACATCAAGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-agtpbp1
No data available
Phenotype
Phenotype resulting from MO1-agtpbp1
Phenotype Fish Figures
brain hydrocephalic, abnormal AB + MO1-agtpbp1 Fig. 5 from Lyons et al., 2013
cerebellum decreased volume, abnormal rw0130aTg + MO1-agtpbp1 (AB) Fig. 6 with image from Wang et al., 2025
eye decreased size, abnormal AB + MO1-agtpbp1 Fig. 5 from Lyons et al., 2013
forebrain decreased volume, abnormal rw0130aTg + MO1-agtpbp1 (AB) Fig. 6 with image from Wang et al., 2025
midbrain decreased volume, abnormal rw0130aTg + MO1-agtpbp1 (AB) Fig. 6 with image from Wang et al., 2025
multicellular organismal movement decreased occurrence, abnormal rw0130aTg + MO1-agtpbp1 (AB) Fig. 7 with image from Wang et al., 2025
olfactory placode decreased size, abnormal AB + MO1-agtpbp1 Fig. 7 from Lyons et al., 2013
olfactory placode morphology, abnormal AB + MO1-agtpbp1 Fig. 7 from Lyons et al., 2013
olfactory placode cilium aggregated, abnormal AB + MO1-agtpbp1 Fig. 7 from Lyons et al., 2013
swimming decreased occurrence, abnormal rw0130aTg + MO1-agtpbp1 (AB) Fig. 7 with image from Wang et al., 2025
swimming behavior decreased occurrence, abnormal rw0130aTg + MO1-agtpbp1 (AB) Fig. 7 with image from Wang et al., 2025
ventricular system edematous, abnormal AB + MO1-agtpbp1 Fig. 5 from Lyons et al., 2013
whole organism curved ventral, abnormal AB + MO1-agtpbp1 Fig. 5 from Lyons et al., 2013
Phenotype of all Fish created by or utilizing MO1-agtpbp1
Phenotype Fish Conditions Figures
eye decreased size, abnormal AB + MO1-agtpbp1 standard conditions Fig. 5 from Lyons et al., 2013
ventricular system edematous, abnormal AB + MO1-agtpbp1 standard conditions Fig. 5 from Lyons et al., 2013
olfactory placode decreased size, abnormal AB + MO1-agtpbp1 standard conditions Fig. 7 from Lyons et al., 2013
olfactory placode morphology, abnormal AB + MO1-agtpbp1 standard conditions Fig. 7 from Lyons et al., 2013
whole organism curved ventral, abnormal AB + MO1-agtpbp1 standard conditions Fig. 5 from Lyons et al., 2013
brain hydrocephalic, abnormal AB + MO1-agtpbp1 standard conditions Fig. 5 from Lyons et al., 2013
olfactory placode cilium aggregated, abnormal AB + MO1-agtpbp1 standard conditions Fig. 7 from Lyons et al., 2013
multicellular organismal movement decreased occurrence, abnormal rw0130aTg + MO1-agtpbp1 (AB) standard conditions Fig. 7 with image from Wang et al., 2025
cerebellum decreased volume, abnormal rw0130aTg + MO1-agtpbp1 (AB) standard conditions Fig. 6 with image from Wang et al., 2025
forebrain decreased volume, abnormal rw0130aTg + MO1-agtpbp1 (AB) standard conditions Fig. 6 with image from Wang et al., 2025
swimming decreased occurrence, abnormal rw0130aTg + MO1-agtpbp1 (AB) standard conditions Fig. 7 with image from Wang et al., 2025
forebrain volume, ameliorated rw0130aTg + MO1-agtpbp1 (AB) chemical treatment by injection: lacosamide Fig. 6 with image from Wang et al., 2025
midbrain decreased volume, abnormal rw0130aTg + MO1-agtpbp1 (AB) standard conditions Fig. 6 with image from Wang et al., 2025
cerebellum volume, ameliorated rw0130aTg + MO1-agtpbp1 (AB) chemical treatment by injection: lacosamide Fig. 6 with image from Wang et al., 2025
swimming behavior decreased occurrence, abnormal rw0130aTg + MO1-agtpbp1 (AB) standard conditions Fig. 7 with image from Wang et al., 2025
swimming behavior occurrence, ameliorated rw0130aTg + MO1-agtpbp1 (AB) chemical treatment by injection: lacosamide Fig. 7 with image from Wang et al., 2025
midbrain volume, ameliorated rw0130aTg + MO1-agtpbp1 (AB) chemical treatment by injection: lacosamide Fig. 6 with image from Wang et al., 2025
swimming occurrence, ameliorated rw0130aTg + MO1-agtpbp1 (AB) chemical treatment by injection: lacosamide Fig. 7 with image from Wang et al., 2025
multicellular organismal movement occurrence, ameliorated rw0130aTg + MO1-agtpbp1 (AB) chemical treatment by injection: lacosamide Fig. 7 with image from Wang et al., 2025
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.