Morpholino

MO2-thrb

ID

ZDB-MRPHLNO-131114-1

Name

MO2-thrb

Previous Names

Splice-blocking MO. (1)

Target

thrb (1)

Sequence

5' - TCTAGAACTTGCAATACCTTTCTTA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-thrb

No data available

Phenotype

Phenotype resulting from MO2-thrb

Phenotype	Fish	Figures
horizontal cell synapse increased amount, abnormal	kj9Tg; mi2007Tg + MO2-thrb	Fig. 5 from Yoshimatsu et al., 2014
red sensitive photoreceptor cell ab3-rho labeling decreased amount, abnormal	WT + MO2-thrb	Fig. 2 , Fig. 3 from DuVal et al., 2018
red sensitive photoreceptor cell decreased amount, abnormal	WT + MO2-thrb	Fig. 2 , Fig. 3 from DuVal et al., 2018
UV sensitive photoreceptor cell ab1-10c9.1 labeling increased amount, abnormal	WT + MO2-thrb	Fig. 2 , Fig. 3 from DuVal et al., 2018
UV sensitive photoreceptor cell increased amount, abnormal	WT + MO2-thrb	Fig. 2 , Fig. 3 from DuVal et al., 2018 Fig. 5 from Yoshimatsu et al., 2014

Phenotype of all Fish created by or utilizing MO2-thrb

Phenotype	Fish	Conditions	Figures
red sensitive photoreceptor cell decreased amount, abnormal	WT + MO2-thrb	standard conditions	Fig. 2 , Fig. 3 from DuVal et al., 2018
red sensitive photoreceptor cell ab3-rho labeling decreased amount, abnormal	WT + MO2-thrb	standard conditions	Fig. 2 , Fig. 3 from DuVal et al., 2018
UV sensitive photoreceptor cell ab1-10c9.1 labeling increased amount, abnormal	WT + MO2-thrb	standard conditions	Fig. 2 , Fig. 3 from DuVal et al., 2018
UV sensitive photoreceptor cell increased amount, abnormal	WT + MO2-thrb	standard conditions	Fig. 2 , Fig. 3 from DuVal et al., 2018
horizontal cell synapse increased amount, abnormal	kj9Tg; mi2007Tg + MO2-thrb	control	Fig. 5 from Yoshimatsu et al., 2014
UV sensitive photoreceptor cell increased amount, abnormal	kj9Tg; mi2007Tg + MO2-thrb	control	Fig. 5 from Yoshimatsu et al., 2014
retina morphology, abnormal	gdf6a^s327/s327 + MO2-thrb	standard conditions	Fig. 2 from DuVal et al., 2018
retinal photoreceptor layer morphology, abnormal	gdf6a^s327/s327 + MO2-thrb	standard conditions	Fig. 2 from DuVal et al., 2018
red sensitive photoreceptor cell decreased amount, abnormal	gdf6a^s327/s327 + MO2-thrb	standard conditions	Fig. 2 from DuVal et al., 2018
retinal photoreceptor layer perforate, abnormal	gdf6a^s327/s327 + MO2-thrb	standard conditions	Fig. 2 from DuVal et al., 2018
red sensitive photoreceptor cell ab3-rho labeling decreased amount, abnormal	gdf6a^s327/s327 + MO2-thrb	standard conditions	Fig. 2 from DuVal et al., 2018
UV sensitive photoreceptor cell decreased amount, abnormal	gdf6a^s327/s327 + MO2-thrb	standard conditions	Fig. 2 from DuVal et al., 2018
UV sensitive photoreceptor cell ab1-10c9.1 labeling decreased amount, abnormal	gdf6a^s327/s327 + MO2-thrb	standard conditions	Fig. 2 from DuVal et al., 2018
blue sensitive photoreceptor cell decreased amount, abnormal	gdf6a^s327/s327 + MO2-thrb	standard conditions	Fig. 2 from DuVal et al., 2018

Citations