Morpholino

MO2-tfpi2

ID
ZDB-MRPHLNO-131016-2
Name
MO2-tfpi2
Previous Names
  • ATG-MO (1)
Target
Sequence
5' - GCTCCGAGTAAATCACACGCCATTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tfpi2
No data available
Phenotype
Phenotype resulting from MO2-tfpi2
Phenotype Fish Figures
head decreased size, abnormal WT + MO2-tfpi2 text only from Zhang et al., 2015
heart malformed, abnormal WT + MO2-tfpi2 Fig. 1 from Zhang et al., 2015
heart contraction decreased rate, abnormal WT + MO2-tfpi2 text only from Zhang et al., 2015
heart development disrupted, abnormal WT + MO2-tfpi2 Fig. 1 from Zhang et al., 2015
hemopoiesis disrupted, abnormal WT + MO2-tfpi2 Fig. 1 from Zhang et al., 2015
locomotion decreased occurrence, abnormal WT + MO2-tfpi2 text only from Zhang et al., 2015
midbrain hindbrain boundary malformed, abnormal AB + MO2-tfpi2 Fig. S4 with image from Zhang et al., 2013
nucleate erythrocyte hemoglobin complex decreased amount, abnormal WT + MO2-tfpi2 Fig. 1 from Zhang et al., 2015
pericardium edematous, abnormal WT + MO2-tfpi2 Fig. 1,  text only from Zhang et al., 2015
whole organism decreased pigmentation, abnormal AB + MO2-tfpi2 Fig. S4 with image from Zhang et al., 2013
yolk increased size, abnormal WT + MO2-tfpi2 Fig. 1,  text only from Zhang et al., 2015
Phenotype of all Fish created by or utilizing MO2-tfpi2
Phenotype Fish Conditions Figures
midbrain hindbrain boundary malformed, abnormal AB + MO2-tfpi2 standard conditions Fig. S4 with image from Zhang et al., 2013
whole organism decreased pigmentation, abnormal AB + MO2-tfpi2 standard conditions Fig. S4 with image from Zhang et al., 2013
nucleate erythrocyte hemoglobin complex decreased amount, abnormal WT + MO1-tfpi2 + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
yolk increased size, abnormal WT + MO1-tfpi2 + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
heart malformed, abnormal WT + MO1-tfpi2 + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
hemopoiesis disrupted, abnormal WT + MO1-tfpi2 + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
heart development disrupted, abnormal WT + MO1-tfpi2 + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
pericardium edematous, abnormal WT + MO1-tfpi2 + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
head decreased size, abnormal WT + MO2-tfpi2 standard conditions text only from Zhang et al., 2015
heart contraction decreased rate, abnormal WT + MO2-tfpi2 standard conditions text only from Zhang et al., 2015
hemopoiesis disrupted, abnormal WT + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
yolk increased size, abnormal WT + MO2-tfpi2 standard conditions Fig. 1,  text only from Zhang et al., 2015
heart malformed, abnormal WT + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
nucleate erythrocyte hemoglobin complex decreased amount, abnormal WT + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
pericardium edematous, abnormal WT + MO2-tfpi2 standard conditions Fig. 1,  text only from Zhang et al., 2015
locomotion decreased occurrence, abnormal WT + MO2-tfpi2 standard conditions text only from Zhang et al., 2015
heart development disrupted, abnormal WT + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.