Morpholino

MO1-tfpi2

ID
ZDB-MRPHLNO-131016-1
Name
MO1-tfpi2
Previous Names
  • exon/intron 2 (1)
Target
Sequence
5' - GAAAATGAACGTACTTGGTATCCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tfpi2
Expressed Gene Anatomy Figures
bmp4 Fig. 2 from Zhang et al., 2015
egr2b Fig. 5 with image from Zhang et al., 2013
elavl3 Fig. 7 with image from Zhang et al., 2013
gata1a Fig. 4 from Zhang et al., 2015
gfap Fig. 8 with image from Zhang et al., 2013
hbae1.1 Fig. 4 from Zhang et al., 2015
her4.2 Fig. 6 with image from Zhang et al., 2013
mib1 Fig. 6 with image from Zhang et al., 2013
myh6 Fig. 2 from Zhang et al., 2015
myh7 Fig. 2 from Zhang et al., 2015
neurog1 Fig. 7 with image from Zhang et al., 2013
notch1a Fig. 6 with image from Zhang et al., 2013
olig2 Fig. 8 with image from Zhang et al., 2013
pax2a Fig. 5 with image from Zhang et al., 2013
Phenotype
Phenotype resulting from MO1-tfpi2
Phenotype Fish Figures
atrioventricular canal malformed, abnormal WT + MO1-tfpi2 Fig. 2 from Zhang et al., 2015
atrium dilated, abnormal WT + MO1-tfpi2 Fig. 2 from Zhang et al., 2015
cardiac muscle cell cardiac myofibril decreased amount, abnormal WT + MO1-tfpi2 Fig. 3 from Zhang et al., 2015
cardiac muscle cell sarcomere disorganized, abnormal WT + MO1-tfpi2 Fig. 3 from Zhang et al., 2015
cardiac muscle cell sarcomere organization disrupted, abnormal WT + MO1-tfpi2 Fig. 3 from Zhang et al., 2015
cardiac muscle cell Z disc disorganized, abnormal WT + MO1-tfpi2 Fig. 3 from Zhang et al., 2015
cardiac ventricle decreased size, abnormal WT + MO1-tfpi2 Fig. 2 from Zhang et al., 2015
fourth ventricle decreased size, abnormal AB + MO1-tfpi2 Fig. 4 with image from Zhang et al., 2013
glial cell (sensu Vertebrata) decreased amount, abnormal mi2001Tg + MO1-tfpi2 Fig. 8 with image from Zhang et al., 2013
head decreased size, abnormal WT + MO1-tfpi2 text only from Zhang et al., 2015
heart malformed, abnormal WT + MO1-tfpi2 Fig. 1 from Zhang et al., 2015
heart contraction decreased rate, abnormal WT + MO1-tfpi2 text only from Zhang et al., 2015
heart development disrupted, abnormal WT + MO1-tfpi2 Fig. 1,  Fig. 2 from Zhang et al., 2015
hemoglobin biosynthetic process disrupted, abnormal WT + MO1-tfpi2 Fig. 4 from Zhang et al., 2015
hemopoiesis disrupted, abnormal WT + MO1-tfpi2 Fig. 1,  Fig. 4 from Zhang et al., 2015
locomotion decreased occurrence, abnormal WT + MO1-tfpi2 text only from Zhang et al., 2015
midbrain hindbrain boundary malformed, abnormal AB + MO1-tfpi2 Fig. 4 with image,  Fig. S4 with image from Zhang et al., 2013
midbrain hindbrain boundary nerve sparse, abnormal AB + MO1-tfpi2 Fig. S6 with image from Zhang et al., 2013
nucleate erythrocyte hemoglobin complex decreased amount, abnormal WT + MO1-tfpi2 Fig. 1,  Fig. 4 from Zhang et al., 2015
pericardium edematous, abnormal WT + MO1-tfpi2 Fig. 1,  text only from Zhang et al., 2015
text only from Zhang et al., 2013
retina photoreceptor cell disorganized, abnormal AB + MO1-tfpi2 Fig. S6 with image from Zhang et al., 2013
third ventricle decreased size, abnormal AB + MO1-tfpi2 Fig. 4 with image from Zhang et al., 2013
whole organism decreased length, abnormal AB + MO1-tfpi2 text only from Zhang et al., 2013
whole organism decreased pigmentation, abnormal AB + MO1-tfpi2 Fig. S4 with image from Zhang et al., 2013
yolk increased size, abnormal WT + MO1-tfpi2 Fig. 1,  text only from Zhang et al., 2015
text only from Zhang et al., 2013
Phenotype of all Fish created by or utilizing MO1-tfpi2
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal AB + MO1-tfpi2 standard conditions text only from Zhang et al., 2013
third ventricle decreased size, abnormal AB + MO1-tfpi2 standard conditions Fig. 4 with image from Zhang et al., 2013
retina photoreceptor cell disorganized, abnormal AB + MO1-tfpi2 standard conditions Fig. S6 with image from Zhang et al., 2013
yolk increased size, abnormal AB + MO1-tfpi2 standard conditions text only from Zhang et al., 2013
fourth ventricle decreased size, abnormal AB + MO1-tfpi2 standard conditions Fig. 4 with image from Zhang et al., 2013
pericardium edematous, abnormal AB + MO1-tfpi2 standard conditions text only from Zhang et al., 2013
midbrain hindbrain boundary nerve sparse, abnormal AB + MO1-tfpi2 standard conditions Fig. S6 with image from Zhang et al., 2013
whole organism decreased pigmentation, abnormal AB + MO1-tfpi2 standard conditions Fig. S4 with image from Zhang et al., 2013
midbrain hindbrain boundary malformed, abnormal AB + MO1-tfpi2 standard conditions Fig. 4 with image,  Fig. S4 with image from Zhang et al., 2013
midbrain hindbrain boundary malformed, abnormal AB + MO1-tfpi2 + MO4-tp53 standard conditions Fig. 4 with image from Zhang et al., 2013
third ventricle decreased size, abnormal AB + MO1-tfpi2 + MO4-tp53 standard conditions Fig. 4 with image from Zhang et al., 2013
fourth ventricle decreased size, abnormal AB + MO1-tfpi2 + MO4-tp53 standard conditions Fig. 4 with image from Zhang et al., 2013
nucleate erythrocyte hemoglobin complex decreased amount, abnormal WT + MO1-tfpi2 standard conditions Fig. 1,  Fig. 4 from Zhang et al., 2015
atrium dilated, abnormal WT + MO1-tfpi2 standard conditions Fig. 2 from Zhang et al., 2015
locomotion decreased occurrence, abnormal WT + MO1-tfpi2 standard conditions text only from Zhang et al., 2015
heart contraction decreased rate, abnormal WT + MO1-tfpi2 standard conditions text only from Zhang et al., 2015
yolk increased size, abnormal WT + MO1-tfpi2 standard conditions Fig. 1,  text only from Zhang et al., 2015
cardiac muscle cell sarcomere disorganized, abnormal WT + MO1-tfpi2 standard conditions Fig. 3 from Zhang et al., 2015
hemopoiesis disrupted, abnormal WT + MO1-tfpi2 standard conditions Fig. 1,  Fig. 4 from Zhang et al., 2015
cardiac ventricle decreased size, abnormal WT + MO1-tfpi2 standard conditions Fig. 2 from Zhang et al., 2015
cardiac muscle cell cardiac myofibril decreased amount, abnormal WT + MO1-tfpi2 standard conditions Fig. 3 from Zhang et al., 2015
hemoglobin biosynthetic process disrupted, abnormal WT + MO1-tfpi2 standard conditions Fig. 4 from Zhang et al., 2015
cardiac muscle cell sarcomere organization disrupted, abnormal WT + MO1-tfpi2 standard conditions Fig. 3 from Zhang et al., 2015
cardiac muscle cell Z disc disorganized, abnormal WT + MO1-tfpi2 standard conditions Fig. 3 from Zhang et al., 2015
head decreased size, abnormal WT + MO1-tfpi2 standard conditions text only from Zhang et al., 2015
heart malformed, abnormal WT + MO1-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
atrioventricular canal malformed, abnormal WT + MO1-tfpi2 standard conditions Fig. 2 from Zhang et al., 2015
heart development disrupted, abnormal WT + MO1-tfpi2 standard conditions Fig. 1,  Fig. 2 from Zhang et al., 2015
pericardium edematous, abnormal WT + MO1-tfpi2 standard conditions Fig. 1,  text only from Zhang et al., 2015
nucleate erythrocyte hemoglobin complex decreased amount, abnormal WT + MO1-tfpi2 + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
heart malformed, abnormal WT + MO1-tfpi2 + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
hemopoiesis disrupted, abnormal WT + MO1-tfpi2 + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
heart development disrupted, abnormal WT + MO1-tfpi2 + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
yolk increased size, abnormal WT + MO1-tfpi2 + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
pericardium edematous, abnormal WT + MO1-tfpi2 + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
glial cell (sensu Vertebrata) decreased amount, abnormal mi2001Tg + MO1-tfpi2 standard conditions Fig. 8 with image from Zhang et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.