Morpholino

MO6-fgfr2

ID
ZDB-MRPHLNO-130911-3
Name
MO6-fgfr2
Previous Names
  • fgfr2b exon 7/intron 7 splice-blocking MO1 (1)
Target
Sequence
5' - CCTGCTTTTTTACCTGGTATGACAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-fgfr2
Expressed Gene Anatomy Figures
bmp5 Fig. 5 with image from Miyake et al., 2013
gad1b Fig. 3 from Miyake et al., 2023
glula Fig. 4 from Miyake et al., 2023
lmx1ba Fig. 5 with image from Miyake et al., 2013
meis2a Fig. 6 with image from Miyake et al., 2013
msx1b Fig. 5 with image from Miyake et al., 2013
nkx6.2 Fig. 6 with image from Miyake et al., 2013
otx2b Fig. 6 with image from Miyake et al., 2013
pax7a Fig. 6 with image from Miyake et al., 2013
plp1a Fig. 4 from Miyake et al., 2023
slc17a6a Fig. 3 from Miyake et al., 2023
wnt1 Fig. 5 with image from Miyake et al., 2013
Phenotype
Phenotype resulting from MO6-fgfr2
Phenotype Fish Figures
cell proliferation in midbrain decreased occurrence, abnormal WT + MO6-fgfr2 Fig. 3 with image from Miyake et al., 2013
diencephalon gad1b expression decreased amount, abnormal WT + MO6-fgfr2 Fig. 3 from Miyake et al., 2023
diencephalon slc17a6a expression decreased amount, abnormal WT + MO6-fgfr2 Fig. 3 from Miyake et al., 2023
forebrain astrocyte glula expression decreased amount, abnormal WT + MO6-fgfr2 Fig. 4 from Miyake et al., 2023
forebrain astrocyte development decreased process quality, abnormal WT + MO6-fgfr2 Fig. 4 from Miyake et al., 2023
forebrain neurogenesis decreased occurrence, abnormal WT + MO6-fgfr2 Fig. 3 from Miyake et al., 2023
forebrain oligodendrocyte plp1a expression increased amount, abnormal WT + MO6-fgfr2 Fig. 4 from Miyake et al., 2023
forebrain oligodendrocyte development increased process quality, abnormal WT + MO6-fgfr2 Fig. 4 from Miyake et al., 2023
midbrain development disrupted, abnormal WT + MO6-fgfr2 Fig. 5 with image,  Fig. 6 with image from Miyake et al., 2013
optic tectum physical object quality, abnormal WT + MO6-fgfr2 Fig. 6 with image from Miyake et al., 2013
telencephalon slc17a6a expression decreased amount, abnormal WT + MO6-fgfr2 Fig. 3 from Miyake et al., 2023
telencephalon gad1b expression decreased amount, abnormal WT + MO6-fgfr2 Fig. 3 from Miyake et al., 2023
Phenotype of all Fish created by or utilizing MO6-fgfr2
Phenotype Fish Conditions Figures
forebrain oligodendrocyte plp1a expression increased amount, abnormal WT + MO6-fgfr2 standard conditions Fig. 4 from Miyake et al., 2023
midbrain development disrupted, abnormal WT + MO6-fgfr2 standard conditions Fig. 5 with image,  Fig. 6 with image from Miyake et al., 2013
telencephalon gad1b expression decreased amount, abnormal WT + MO6-fgfr2 standard conditions Fig. 3 from Miyake et al., 2023
forebrain astrocyte glula expression decreased amount, abnormal WT + MO6-fgfr2 standard conditions Fig. 4 from Miyake et al., 2023
diencephalon gad1b expression decreased amount, abnormal WT + MO6-fgfr2 standard conditions Fig. 3 from Miyake et al., 2023
telencephalon slc17a6a expression decreased amount, abnormal WT + MO6-fgfr2 standard conditions Fig. 3 from Miyake et al., 2023
cell proliferation in midbrain decreased occurrence, abnormal WT + MO6-fgfr2 standard conditions Fig. 3 with image from Miyake et al., 2013
forebrain astrocyte development decreased process quality, abnormal WT + MO6-fgfr2 standard conditions Fig. 4 from Miyake et al., 2023
optic tectum physical object quality, abnormal WT + MO6-fgfr2 standard conditions Fig. 6 with image from Miyake et al., 2013
forebrain neurogenesis decreased occurrence, abnormal WT + MO6-fgfr2 standard conditions Fig. 3 from Miyake et al., 2023
diencephalon slc17a6a expression decreased amount, abnormal WT + MO6-fgfr2 standard conditions Fig. 3 from Miyake et al., 2023
forebrain oligodendrocyte development increased process quality, abnormal WT + MO6-fgfr2 standard conditions Fig. 4 from Miyake et al., 2023
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.