Morpholino

MO1-fgf22

ID
ZDB-MRPHLNO-130911-1
Name
MO1-fgf22
Previous Names
  • fgf22 exon 2/intron 2 spliceblocking MO1 (1)
Target
Sequence
5' - ATGCGATGTACCTACCGATCCGAAAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fgf22
No data available
Phenotype
Phenotype resulting from MO1-fgf22
Phenotype Fish Figures
brain astrocyte glula expression decreased amount, abnormal WT + MO1-fgf22 Fig. 4 from Miyake et al., 2023
cell proliferation in midbrain decreased occurrence, abnormal WT + MO1-fgf22 Fig. 3 with image from Miyake et al., 2013
diencephalon neurog1 expression decreased amount, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
diencephalon isl1a expression decreased amount, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
diencephalon ventral region slc17a6a expression decreased amount, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
dorsal telencephalon anterior region neurog1 expression decreased amount, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
dorsal telencephalon anterior region slc17a6a expression decreased amount, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
epiphysis isl1a expression decreased amount, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
forebrain ascl1a expression decreased amount, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
forebrain morphology, abnormal WT + MO1-fgf22 Fig. 2 with image from Miyake et al., 2013
forebrain astrocyte development decreased process quality, abnormal WT + MO1-fgf22 Fig. 4 from Miyake et al., 2023
forebrain neurogenesis decreased occurrence, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
forebrain oligodendrocyte plp1a expression increased amount, abnormal WT + MO1-fgf22 Fig. 4 from Miyake et al., 2023
forebrain oligodendrocyte olig2 expression increased amount, abnormal WT + MO1-fgf22 Fig. 4 from Miyake et al., 2023
forebrain oligodendrocyte development increased process quality, abnormal WT + MO1-fgf22 Fig. 4 from Miyake et al., 2023
forebrain development disrupted, abnormal WT + MO1-fgf22 Fig. 2 with image from Miyake et al., 2013
midbrain plp1a expression mislocalised, abnormal WT + MO1-fgf22 Fig. 4 from Miyake et al., 2023
midbrain morphology, abnormal WT + MO1-fgf22 Fig. 2 with image from Miyake et al., 2013
midbrain development disrupted, abnormal WT + MO1-fgf22 Fig. 2 with image,  Fig. 5 with image from Miyake et al., 2013
midbrain hindbrain boundary morphology, abnormal WT + MO1-fgf22 Fig. 2 with image from Miyake et al., 2013
midbrain-hindbrain boundary development disrupted, abnormal WT + MO1-fgf22 + MO4-tp53 Fig. 2 with image from Miyake et al., 2013
roof plate formation disrupted, abnormal WT + MO1-fgf22 Fig. 4 with image from Miyake et al., 2013
roof plate midbrain region increased width, abnormal WT + MO1-fgf22 Fig. 4 with image from Miyake et al., 2013
telencephalon isl1a expression decreased amount, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
telencephalon gad1b expression decreased amount, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
ventral telencephalon dlx2a expression decreased amount, abnormal WT + MO1-fgf22 Fig. 2 from Miyake et al., 2023
ventral telencephalon gad1b expression decreased amount, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
ventral thalamus dlx2a expression decreased amount, abnormal WT + MO1-fgf22 Fig. 2 from Miyake et al., 2023
Phenotype of all Fish created by or utilizing MO1-fgf22
Phenotype Fish Conditions Figures
forebrain oligodendrocyte plp1a expression increased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 4 from Miyake et al., 2023
diencephalon ventral region slc17a6a expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
roof plate midbrain region increased width, abnormal WT + MO1-fgf22 standard conditions Fig. 4 with image from Miyake et al., 2013
midbrain plp1a expression mislocalised, abnormal WT + MO1-fgf22 standard conditions Fig. 4 from Miyake et al., 2023
ventral thalamus dlx2a expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 2 from Miyake et al., 2023
ventral telencephalon gad1b expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
dorsal telencephalon anterior region neurog1 expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
roof plate formation disrupted, abnormal WT + MO1-fgf22 standard conditions Fig. 4 with image from Miyake et al., 2013
cell proliferation in midbrain decreased occurrence, abnormal WT + MO1-fgf22 standard conditions Fig. 3 with image from Miyake et al., 2013
midbrain hindbrain boundary morphology, abnormal WT + MO1-fgf22 standard conditions Fig. 2 with image from Miyake et al., 2013
forebrain oligodendrocyte development increased process quality, abnormal WT + MO1-fgf22 standard conditions Fig. 4 from Miyake et al., 2023
ventral telencephalon dlx2a expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 2 from Miyake et al., 2023
telencephalon isl1a expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
forebrain ascl1a expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
forebrain development disrupted, abnormal WT + MO1-fgf22 standard conditions Fig. 2 with image from Miyake et al., 2013
telencephalon gad1b expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
midbrain-hindbrain boundary development disrupted, abnormal WT + MO1-fgf22 standard conditions Fig. 2 with image from Miyake et al., 2013
diencephalon isl1a expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
epiphysis isl1a expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
forebrain oligodendrocyte olig2 expression increased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 4 from Miyake et al., 2023
midbrain development disrupted, abnormal WT + MO1-fgf22 standard conditions Fig. 2 with image,  Fig. 5 with image from Miyake et al., 2013
diencephalon neurog1 expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
midbrain morphology, abnormal WT + MO1-fgf22 standard conditions Fig. 2 with image from Miyake et al., 2013
brain astrocyte glula expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 4 from Miyake et al., 2023
forebrain morphology, abnormal WT + MO1-fgf22 standard conditions Fig. 2 with image from Miyake et al., 2013
forebrain neurogenesis decreased occurrence, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
dorsal telencephalon anterior region slc17a6a expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
forebrain astrocyte development decreased process quality, abnormal WT + MO1-fgf22 standard conditions Fig. 4 from Miyake et al., 2023
forebrain development disrupted, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain-hindbrain boundary development disrupted, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain development disrupted, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain hindbrain boundary morphology, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
forebrain morphology, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain morphology, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.