Morpholino
MO1-dre-mir-21-2
- ID
- ZDB-MRPHLNO-130806-1
- Name
- MO1-dre-mir-21-2
- Previous Names
- Target
- Sequence
-
5' - ACTCAAAGCCAACACCAGTCTGATAAGCTAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a multi-blocker morpholino that targets both Drosha and Dicer processing sites in pre-mir21-2.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dre-mir-21-2
No data available
Phenotype
Phenotype resulting from MO1-dre-mir-21-2
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-dre-mir-21-2
1 - 5 of 18 Show all
Citations
- Wu, Y., Lou, Q.Y., Ge, F., Xiong, Q. (2017) Quantitative Proteomics Analysis Reveals Novel Targets of miR-21 in Zebrafish Embryos. Scientific Reports. 7:4022
- Banjo, T., Grajcarek, J., Yoshino, D., Osada, H., Miyasaka, K.Y., Kida, Y.S., Ueki, Y., Nagayama, K., Kawakami, K., Matsumoto, T., Sato, M., and Ogura, T. (2013) Haemodynamically dependent valvulogenesis of zebrafish heart is mediated by flow-dependent expression of miR-21. Nature communications. 4:1978
- Kolpa, H.J., Peal, D.S., Lynch, S.N., Giokas, A.C., Ghatak, S., Misra, S., Norris, R.A., MacRae, C.A., Markwald, R.R., Ellinor, P., Bischoff, J., and Milan, D.J. (2013) miR-21 represses Pdcd4 during cardiac valvulogenesis. Development (Cambridge, England). 140(10):2172-80
1 - 3 of 3
Show