Morpholino
MO2-pip4k2aa
- ID
- ZDB-MRPHLNO-130801-3
- Name
- MO2-pip4k2aa
- Previous Names
-
- ATGMO zPIP4Ka (1)
- Target
- Sequence
-
5' - ACAGTGTTACTAGCCGAGGCCATTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pip4k2aa
Expressed Gene | Anatomy | Figures |
---|---|---|
lmo2 |
Fig. S7 ![]() |
|
mespaa |
Fig. 7 ![]() |
|
pip4k2aa |
|
Fig. 2,
Fig. 5
from Elouarrat et al., 2013 |
tal1 |
Fig. S7 ![]() |
1 - 4 of 4
Phenotype
Phenotype resulting from MO2-pip4k2aa
1 - 5 of 15 Show all
Phenotype of all Fish created by or utilizing MO2-pip4k2aa
1 - 5 of 18 Show all
Citations
- Stijf-Bultsma, Y., Sommer, L., Tauber, M., Baalbaki, M., Giardoglou, P., Jones, D.R., Gelato, K.A., van Pelt, J., Shah, Z., Rahnamoun, H., Toma, C., Anderson, K.E., Hawkins, P., Lauberth, S.M., Haramis, A.P., Hart, D., Fischle, W., Divecha, N. (2015) The basal transcription complex component TAF3 transduces changes in nuclear phosphoinositides into transcriptional output. Molecular Cell. 58:453-67
- Elouarrat, D., van der Velden, Y., Jones, D.R., Moolenaar, W.H., Divecha, N., and Haramis, A.P. (2013) Role of phosphatidylinositol 5-phosphate 4-kinase α in zebrafish development. The international journal of biochemistry & cell biology. 45(7):1293-301
1 - 2 of 2
Show