ZFIN ID: ZDB-MRPHLNO-130726-3
Morpholino Name: MO1-kcnj10b
Target: kcnj10b (1)
Sequence:
5' - CCGAGGTCATCTAGGGAAGAAAGAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-kcnj10b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-kcnj10b No data available
PHENOTYPE
Phenotype resulting from MO1-kcnj10b
Phenotype Figures
embryo development disrupted, abnormal Fig. S6 with image from Mahmood et al., 2013
whole organism decreased size, abnormal Fig. S6 with image from Mahmood et al., 2013

Phenotype of all Fish created by or utilizing MO1-kcnj10b
Phenotype Fish Conditions Figures
embryo development disrupted, abnormal TL + MO1-kcnj10b standard conditions Fig. S6 with image from Mahmood et al., 2013
whole organism decreased size, abnormal TL + MO1-kcnj10b standard conditions Fig. S6 with image from Mahmood et al., 2013
OTHER MO1-kcnj10b MORPHOLINO PAGESNo links to external sites
CITATIONS (1)