Morpholino
MO2-vhl
- ID
- ZDB-MRPHLNO-130514-1
- Name
- MO2-vhl
- Previous Names
-
- vhl-ATG (1)
- Target
- Sequence
-
5' - GGCATCGTCAAAGACAGGACAGTTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-vhl
Expressed Gene | Anatomy | Figures |
---|---|---|
epor |
Fig. 4
from Chen et al., 2015 |
|
kdrl |
Fig. 4,
Fig. 5
from Chen et al., 2015 |
|
myb |
Fig. 2
from Lim et al., 2017 |
|
pdgfba |
Fig. 1
from Lim et al., 2017 |
|
pdgfrb |
Fig. 1
from Lim et al., 2017 |
1 - 5 of 7 Show all
Phenotype
Phenotype resulting from MO2-vhl
1 - 5 of 31 Show all
Phenotype of all Fish created by or utilizing MO2-vhl
1 - 5 of 35 Show all
Citations
- Wrighton, P.J., Shwartz, A., Heo, J.M., Quenzer, E.D., LaBella, K.A., Harper, J.W., Goessling, W. (2021) Quantitative intravital imaging reveals in vivo dynamics of physiological-stress induced mitophagy. Journal of Cell Science. 134(4):
- Lim, S.E., Esain, V., Kwan, W., Theodore, L.N., Cortes, M., Frost, I.M., Liu, S.Y., North, T.E. (2017) HIF1α-induced PDGFRβ signaling promotes developmental HSC production via IL-6 activation. Experimental hematology. 46:83-95.e6
- Chen, Y.H., Chang, C.F., Lai, Y.Y., Sun, C.Y., Ding, Y.J., Tsai, J.N. (2015) von Hippel-Lindau gene plays a role during zebrafish pronephros development. In vitro cellular & developmental biology. Animal. 51(10):1023-32
- Harris, J.M., Esain, V., Frechette, G.M., Harris, L.J., Cox, A.G., Cortes, M., Garnaas, M.K., Carroll, K.J., Cutting, C.C., Khan, T., Elks, P.M., Renshaw, S.A., Dickinson, B.C., Chang, C.J., Murphy, M.P., Paw, B.H., Vander Heiden, M.G., Goessling, W., and North, T.E. (2013) Glucose metabolism impacts the spatio-temporal onset and magnitude of HSC induction in vivo. Blood. 121(13):2483-2493
1 - 4 of 4
Show