Morpholino

MO2-vhl

ID
ZDB-MRPHLNO-130514-1
Name
MO2-vhl
Previous Names
  • vhl-ATG (1)
Target
Sequence
5' - GGCATCGTCAAAGACAGGACAGTTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-vhl
Phenotype
Phenotype resulting from MO2-vhl
Phenotype Fish Figures
blood increased accumulation yolk, abnormal WT + MO2-vhl Fig. 4 from Chen et al., 2015
dorsal aorta dilated, abnormal WT + MO2-vhl Fig. 5 from Chen et al., 2015
glomerular filtration disrupted, abnormal WT + MO2-vhl Fig. 2 from Chen et al., 2015
hematopoietic multipotent progenitor cell increased amount, abnormal la2Tg; sd2Tg + MO2-vhl Fig. 2 from Lim et al., 2017
lateral dorsal aorta dilated, abnormal WT + MO2-vhl Fig. 5 from Chen et al., 2015
podocyte vegfaa expression increased amount, abnormal WT + MO2-vhl Fig. 5 from Chen et al., 2015
pronephric duct curved, abnormal li1Tg + MO2-vhl Fig. 1 from Chen et al., 2015
pronephric duct cystic, abnormal li1Tg + MO2-vhl Fig. 1 from Chen et al., 2015
pronephric glomerulus atrophied, abnormal li1Tg + MO2-vhl Fig. 1 from Chen et al., 2015
pronephric glomerulus cystic, abnormal li1Tg + MO2-vhl Fig. 1 from Chen et al., 2015
pronephric glomerulus disorganized, abnormal WT + MO2-vhl Fig. 3 from Chen et al., 2015
pronephric glomerulus increased size, abnormal WT + MO2-vhl Fig. 5 from Chen et al., 2015
pronephric glomerulus swollen, abnormal li1Tg + MO2-vhl Fig. 1 from Chen et al., 2015
pronephric glomerulus bicellular tight junction decreased amount, abnormal WT + MO2-vhl Fig. 3 from Chen et al., 2015
pronephric tubule curved, abnormal li1Tg + MO2-vhl Fig. 1 from Chen et al., 2015
pronephric tubule cystic, abnormal li1Tg + MO2-vhl Fig. 1 from Chen et al., 2015
pronephric tubule distended, abnormal li1Tg + MO2-vhl Fig. 1 from Chen et al., 2015
pronephros decreased functionality, abnormal WT + MO2-vhl Fig. 2 from Chen et al., 2015
pronephros shape, abnormal WT + MO2-vhl Fig. 5 from Chen et al., 2015
pronephros development disrupted, abnormal li1Tg + MO2-vhl Fig. 1Fig. 5 from Chen et al., 2015
subintestinal vein increased branchiness, abnormal WT + MO2-vhl Fig. 4 from Chen et al., 2015
subintestinal vein spatial pattern, abnormal WT + MO2-vhl Fig. 4 from Chen et al., 2015
subintestinal vein sprouting angiogenesis increased occurrence, abnormal WT + MO2-vhl Fig. 4 from Chen et al., 2015
ventral wall of dorsal aorta hematopoietic stem cell myb expression increased amount, abnormal WT + MO2-vhl Fig. 2 from Lim et al., 2017
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression increased amount, abnormal WT + MO2-vhl Fig. 2 from Lim et al., 2017
whole organism kdrl expression increased amount, abnormal WT + MO2-vhl Fig. 4 from Chen et al., 2015
whole organism pdgfba expression increased amount, abnormal WT + MO2-vhl Fig. 1 from Lim et al., 2017
whole organism pdgfrb expression increased amount, abnormal WT + MO2-vhl Fig. 1 from Lim et al., 2017
whole organism epor expression increased amount, abnormal WT + MO2-vhl Fig. 4 from Chen et al., 2015
whole organism vegfaa expression increased amount, abnormal WT + MO2-vhl Fig. 4 from Chen et al., 2015
Phenotype of all Fish created by or utilizing MO2-vhl
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta hematopoietic stem cell myb expression increased amount, abnormal WT + MO2-vhl control Fig. 2 from Lim et al., 2017
subintestinal vein spatial pattern, abnormal WT + MO2-vhl standard conditions Fig. 4 from Chen et al., 2015
subintestinal vein sprouting angiogenesis increased occurrence, abnormal WT + MO2-vhl standard conditions Fig. 4 from Chen et al., 2015
whole organism epor expression increased amount, abnormal WT + MO2-vhl standard conditions Fig. 4 from Chen et al., 2015
subintestinal vein increased branchiness, abnormal WT + MO2-vhl standard conditions Fig. 4 from Chen et al., 2015
pronephros shape, abnormal WT + MO2-vhl standard conditions Fig. 5 from Chen et al., 2015
pronephric glomerulus bicellular tight junction decreased amount, abnormal WT + MO2-vhl standard conditions Fig. 3 from Chen et al., 2015
podocyte vegfaa expression increased amount, abnormal WT + MO2-vhl standard conditions Fig. 5 from Chen et al., 2015
whole organism pdgfrb expression increased amount, abnormal WT + MO2-vhl standard conditions Fig. 1 from Lim et al., 2017
glomerular filtration disrupted, abnormal WT + MO2-vhl standard conditions Fig. 2 from Chen et al., 2015
blood increased accumulation yolk, abnormal WT + MO2-vhl standard conditions Fig. 4 from Chen et al., 2015
whole organism pdgfba expression increased amount, abnormal WT + MO2-vhl standard conditions Fig. 1 from Lim et al., 2017
pronephros development disrupted, abnormal WT + MO2-vhl standard conditions Fig. 5 from Chen et al., 2015
pronephric glomerulus increased size, abnormal WT + MO2-vhl standard conditions Fig. 5 from Chen et al., 2015
pronephric glomerulus disorganized, abnormal WT + MO2-vhl standard conditions Fig. 3 from Chen et al., 2015
lateral dorsal aorta dilated, abnormal WT + MO2-vhl standard conditions Fig. 5 from Chen et al., 2015
whole organism kdrl expression increased amount, abnormal WT + MO2-vhl standard conditions Fig. 4 from Chen et al., 2015
dorsal aorta dilated, abnormal WT + MO2-vhl standard conditions Fig. 5 from Chen et al., 2015
whole organism vegfaa expression increased amount, abnormal WT + MO2-vhl standard conditions Fig. 4 from Chen et al., 2015
pronephros decreased functionality, abnormal WT + MO2-vhl standard conditions Fig. 2 from Chen et al., 2015
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression increased amount, abnormal WT + MO2-vhl control Fig. 2 from Lim et al., 2017
pronephric tubule distended, abnormal li1Tg + MO2-vhl standard conditions Fig. 1 from Chen et al., 2015
pronephric glomerulus cystic, abnormal li1Tg + MO2-vhl standard conditions Fig. 1 from Chen et al., 2015
pronephric duct curved, abnormal li1Tg + MO2-vhl standard conditions Fig. 1 from Chen et al., 2015
pronephric glomerulus atrophied, abnormal li1Tg + MO2-vhl standard conditions Fig. 1 from Chen et al., 2015
pronephric tubule cystic, abnormal li1Tg + MO2-vhl standard conditions Fig. 1 from Chen et al., 2015
pronephric glomerulus swollen, abnormal li1Tg + MO2-vhl standard conditions Fig. 1 from Chen et al., 2015
pronephros development disrupted, abnormal li1Tg + MO2-vhl standard conditions Fig. 1 from Chen et al., 2015
pronephric duct cystic, abnormal li1Tg + MO2-vhl standard conditions Fig. 1 from Chen et al., 2015
pronephric tubule curved, abnormal li1Tg + MO2-vhl standard conditions Fig. 1 from Chen et al., 2015
hematopoietic multipotent progenitor cell increased amount, abnormal la2Tg; sd2Tg + MO2-vhl standard conditions Fig. 2 from Lim et al., 2017
ventral wall of dorsal aorta hematopoietic stem cell myb expression amount, ameliorated WT + MO1-pdgfrb + MO2-vhl control Fig. 2 from Lim et al., 2017
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression amount, ameliorated WT + MO1-pdgfrb + MO2-vhl control Fig. 2 from Lim et al., 2017
hematopoietic multipotent progenitor cell decreased amount, ameliorated la2Tg; sd2Tg + MO1-pdgfrb + MO2-vhl standard conditions Fig. 2 from Lim et al., 2017
Citations