Morpholino

MO1-rpl22l1

ID

ZDB-MRPHLNO-130422-2

Name

MO1-rpl22l1

Previous Names

None

Target

Sequence

5' - GGTTTCCTGTTAGTGATAAAACAGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rpl22l1

Expressed Gene	Anatomy	Figures
cdh17	pronephros	Fig. 4 from Zhang et al., 2013
efnb2a	dorsal aorta	Fig. 4 from Zhang et al., 2013
hbae1.1	hematopoietic system erythroid progenitor cell kidney erythroid progenitor cell	Fig. 4 from Zhang et al., 2013
ikzf1	(not) common lymphoid progenitor	Fig. 3 from Zhang et al., 2013
kdrl	vasculature	Fig. 4 from Zhang et al., 2013
lck	(not) pro-T cell (not) T cell	Fig. 3 from Zhang et al., 2013
lyz	kidney common myeloid progenitor ventral wall of dorsal aorta common myeloid progenitor	Fig. 4 from Zhang et al., 2013
myb	kidney hematopoietic stem cell thymus hematopoietic stem cell ventral wall of dorsal aorta hematopoietic stem cell	Fig. 4 , Fig. 7 from Zhang et al., 2013
rag1	(not) common lymphoid progenitor	Fig. 3 from Zhang et al., 2013
runx1	common myeloid progenitor hematopoietic multipotent progenitor cell ventral wall of dorsal aorta hematopoietic stem cell	Fig. 4 , Fig. 5 , Fig. 7 from Zhang et al., 2013
trbc2	(not) alpha-beta T cell (not) T cell	Fig. 3 from Zhang et al., 2013

Phenotype

Phenotype resulting from MO1-rpl22l1

Phenotype	Fish	Figures
alpha-beta T cell aplastic/hypoplastic, abnormal	WT + MO1-rpl22l1	Fig. 3 from Zhang et al., 2013
alpha-beta T cell differentiation arrested, abnormal	WT + MO1-rpl22l1	Fig. 3 from Zhang et al., 2013
gamma-delta T cell aplastic/hypoplastic, abnormal	WT + MO1-rpl22l1	Fig. 3 from Zhang et al., 2013
gamma-delta T cell differentiation arrested, abnormal	WT + MO1-rpl22l1	Fig. 3 from Zhang et al., 2013
T cell aplastic/hypoplastic, abnormal	WT + MO1-rpl22l1	Fig. 3 from Zhang et al., 2013
T cell differentiation arrested, abnormal	cz2Tg + MO1-rpl22l1	Fig. 2 , Fig. 3 from Zhang et al., 2013
ventral wall of dorsal aorta hematopoietic stem cell differentiation decreased process quality, abnormal	la2Tg + MO1-rpl22l1	Fig. 3 from Zhang et al., 2013

Phenotype of all Fish created by or utilizing MO1-rpl22l1

Phenotype	Fish	Conditions	Figures
gamma-delta T cell aplastic/hypoplastic, abnormal	WT + MO1-rpl22l1	standard conditions	Fig. 3 from Zhang et al., 2013
gamma-delta T cell differentiation arrested, abnormal	WT + MO1-rpl22l1	standard conditions	Fig. 3 from Zhang et al., 2013
alpha-beta T cell differentiation arrested, abnormal	WT + MO1-rpl22l1	standard conditions	Fig. 3 from Zhang et al., 2013
alpha-beta T cell aplastic/hypoplastic, abnormal	WT + MO1-rpl22l1	standard conditions	Fig. 3 from Zhang et al., 2013
T cell differentiation arrested, abnormal	WT + MO1-rpl22l1	standard conditions	Fig. 3 from Zhang et al., 2013
T cell aplastic/hypoplastic, abnormal	WT + MO1-rpl22l1	standard conditions	Fig. 3 from Zhang et al., 2013
T cell differentiation arrested, abnormal	cz2Tg + MO1-rpl22l1	standard conditions	Fig. 2 from Zhang et al., 2013
ventral wall of dorsal aorta hematopoietic stem cell differentiation decreased process quality, abnormal	la2Tg + MO1-rpl22l1	standard conditions	Fig. 3 from Zhang et al., 2013
T cell differentiation arrested, abnormal	tp53^zdf1/zdf1; cz2Tg + MO1-rpl22l1	standard conditions	Fig. 2 from Zhang et al., 2013

Citations