Morpholino

MO1-opa1

ID
ZDB-MRPHLNO-130417-1
Name
MO1-opa1
Previous Names
None
Target
Sequence
5' - GATGAGTTTAGGATCTCTTTGCAGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-opa1
Phenotype
Phenotype resulting from MO1-opa1
Phenotype Fish Figures
blood circulation disrupted, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
cardiac muscle cell increased size, abnormal WT + MO1-opa1 Fig. 6 from Li et al., 2014
cellular respiration decreased process quality, abnormal AB + MO1-opa1 Fig. 7 with image from Rahn et al., 2013
eye decreased size, abnormal AB + MO1-opa1 Fig. 2 with imageFig. 3 with image from Rahn et al., 2013
eye edematous, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
fourth ventricle increased size, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
heart decreased size, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
heart contraction decreased rate, abnormal AB + MO1-opa1 Fig. 3 with image from Rahn et al., 2013
heart looping disrupted, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
midbrain hindbrain boundary inconspicuous, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
muscle contractile fiber disorganized, abnormal AB + MO1-opa1 Fig. 4 with image from Rahn et al., 2013
muscle cell mitochondrion broken, abnormal AB + MO1-opa1 Fig. 4 with image from Rahn et al., 2013
nucleate erythrocyte accumulation heart, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
pectoral fin decreased size, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
pericardium edematous, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
startle response decreased process quality, abnormal AB + MO1-opa1 Fig. SMovie 2 from Rahn et al., 2013
swimming behavior disrupted, abnormal AB + MO1-opa1 Fig. SMovie 2 from Rahn et al., 2013
whole organism dead, abnormal AB + MO1-opa1 text only from Rahn et al., 2013
whole organism opa1 expression decreased amount, abnormal WT + MO1-opa1 Fig. 6 from Li et al., 2014
whole organism decreased length, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
yolk edematous, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
yolk increased size, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
Phenotype of all Fish created by or utilizing MO1-opa1
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
fourth ventricle increased size, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
heart looping disrupted, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
muscle cell mitochondrion broken, abnormal AB + MO1-opa1 standard conditions Fig. 4 with image from Rahn et al., 2013
whole organism dead, abnormal AB + MO1-opa1 standard conditions text only from Rahn et al., 2013
eye decreased size, abnormal AB + MO1-opa1 standard conditions Fig. 2 with imageFig. 3 with image from Rahn et al., 2013
midbrain hindbrain boundary inconspicuous, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
nucleate erythrocyte accumulation heart, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
heart decreased size, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
pericardium edematous, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
eye edematous, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
yolk edematous, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
cellular respiration decreased process quality, abnormal AB + MO1-opa1 standard conditions Fig. 7 with image from Rahn et al., 2013
heart contraction decreased rate, abnormal AB + MO1-opa1 standard conditions Fig. 3 with image from Rahn et al., 2013
startle response decreased process quality, abnormal AB + MO1-opa1 standard conditions Fig. SMovie 2 from Rahn et al., 2013
blood circulation disrupted, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
pectoral fin decreased size, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
muscle contractile fiber disorganized, abnormal AB + MO1-opa1 standard conditions Fig. 4 with image from Rahn et al., 2013
yolk increased size, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
swimming behavior disrupted, abnormal AB + MO1-opa1 standard conditions Fig. SMovie 2 from Rahn et al., 2013
whole organism opa1 expression decreased amount, abnormal WT + MO1-opa1 standard conditions Fig. 6 from Li et al., 2014
cardiac muscle cell increased size, abnormal WT + MO1-opa1 standard conditions Fig. 6 from Li et al., 2014
dermis mitochondrion morphology, abnormal mitfaw2/w2; zf154Tg + MO1-opa1 standard conditions Fig. 3 from Eijkenboom et al., 2019
whole organism anterior-posterior axis curved, abnormal mitfaw2/w2; zf154Tg + MO1-opa1 standard conditions Fig. 2 from Eijkenboom et al., 2019
Citations