Morpholino

MO3-arxa

ID
ZDB-MRPHLNO-130327-1
Name
MO3-arxa
Previous Names
  • intron 2 – exon 2 junction (1)
Target
Sequence
5' - GCGTCATATTTACCTGGTGAACACA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-arxa
Phenotype
Phenotype resulting from MO3-arxa
Phenotype of all Fish created by or utilizing MO3-arxa
Phenotype Fish Conditions Figures
pancreatic A cell decreased amount, abnormal WT + MO3-arxa standard conditions Fig. 4 with image from Djiotsa et al., 2012
glucagon secreting cell decreased amount, abnormal WT + MO3-arxa standard conditions Fig. 4 with image from Djiotsa et al., 2012
dorsal telencephalon EGFP expression increased amount, abnormal zf1036Tg + MO3-arxa + MO4-arxa standard conditions Fig. 5 from Ishibashi et al., 2015
dorsal telencephalon EGFP expression increased amount, abnormal zf1038Tg + MO3-arxa + MO4-arxa standard conditions Fig. 5 from Ishibashi et al., 2015
ventral thalamus neuron projection EGFP expression spatial pattern, abnormal zf1039Tg + MO3-arxa + MO4-arxa standard conditions Fig. 7 from Ishibashi et al., 2015
telencephalon development disrupted, abnormal zf1039Tg + MO3-arxa + MO4-arxa standard conditions Fig. 7 from Ishibashi et al., 2015
ventral thalamus lateral region EGFP expression increased amount, abnormal zf1039Tg + MO3-arxa + MO4-arxa standard conditions Fig. 5 from Ishibashi et al., 2015
ventral thalamus medial region EGFP expression absent, abnormal zf1039Tg + MO3-arxa + MO4-arxa standard conditions Fig. 5Fig. 7 from Ishibashi et al., 2015
thalamus development disrupted, abnormal zf1039Tg + MO3-arxa + MO4-arxa standard conditions Fig. 7 from Ishibashi et al., 2015
ventral thalamus neuron projection disorganized, abnormal zf1039Tg + MO3-arxa + MO4-arxa standard conditions Fig. 7 from Ishibashi et al., 2015
pancreatic B cell regeneration increased occurrence, abnormal ki103Tg; s892Tg; zf5Tg + MO3-arxa chemical ablation: pancreatic B cell, chemical treatment by environment: metronidazole Fig. 3 with image from Lu et al., 2016
glucagon secreting cell ab1-gcg labeling absent, abnormal ki103Tg; s892Tg; zf5Tg + MO3-arxa chemical ablation: pancreatic B cell, chemical treatment by environment: metronidazole Fig. 3 with image from Lu et al., 2016
pancreatic A cell absent, abnormal ki103Tg; s892Tg; zf5Tg + MO3-arxa chemical ablation: pancreatic B cell, chemical treatment by environment: metronidazole Fig. 3 with image from Lu et al., 2016
Citations