Morpholino
MO1-dio3b
- ID
- ZDB-MRPHLNO-130306-3
- Name
- MO1-dio3b
- Previous Names
- None
- Target
- Sequence
-
5' - CTGCGGAGCCCTGCAGCATCTCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dio3b
Expressed Gene | Anatomy | Figures |
---|---|---|
aldh1a2 | (all 4) |
Fig. 4 ![]() |
arr3a |
Fig. 6 ![]() |
|
cyp26c1 | (all 4) |
Fig. 4 ![]() |
foxa2 |
Fig. 5
from Heijlen et al., 2014 |
|
opn1sw1 |
Fig. 6 ![]() |
1 - 5 of 9 Show all
Phenotype
Phenotype resulting from MO1-dio3b
1 - 5 of 41 Show all
Phenotype of all Fish created by or utilizing MO1-dio3b
1 - 5 of 44 Show all
Citations
- van der Spek, A.H., Jim, K.K., Karaczyn, A., van Beeren, H.C., Ackermans, M.T., Darras, V.M., Vandenbroucke-Grauls, C.M.J.E., Hernandez, A., Brouwer, M.C., Fliers, E., van de Beek, D., Boelen, A. (2017) The Thyroid Hormone Inactivating Type 3 Deiodinase is Essential for Optimal Neutrophil Function - observations from 3 species. Endocrinology. 159(2):826-835
- Houbrechts, A.M., Vergauwen, L., Bagci, E., Van Houcke, J., Heijlen, M., Kulemeka, B., Hyde, D.R., Knapen, D., Darras, V.M. (2016) Deiodinase knockdown affects zebrafish eye development at the level of gene expression, morphology and function. Molecular and Cellular Endocrinology. 424:81-93
- Bagci, E., Heijlen, M., Vergauwen, L., Hagenaars, A., Houbrechts, A.M., Esguerra, C.V., Blust, R., Darras, V.M., Knapen, D. (2015) Deiodinase Knockdown during Early Zebrafish Development Affects Growth, Development, Energy Metabolism, Motility and Phototransduction. PLoS One. 10:e0123285
- Heijlen, M., Houbrechts, A.M., Bagci, E., Van Herck, S.L., Kersseboom, S., Esguerra, C.V., Blust, R., Visser, T.J., Knapen, D., and Darras, V.M. (2014) Knockdown of type 3 iodothyronine deiodinase severely perturbs both embryonic and early larval development in zebrafish. Endocrinology. 155(4):1547-1559
- Bohnsack, B.L., and Kahana, A. (2013) Thyroid hormone and retinoic acid interact to regulate zebrafish craniofacial neural crest development. Developmental Biology. 373(2):300-309
- Heijlen, M., Houbrechts, A.M., and Darras, V.M. (2013) Zebrafish as a model to study peripheral thyroid hormone metabolism in vertebrate development. General and comparative endocrinology. 188:289-96
1 - 6 of 6
Show