Morpholino

MO1-lrp1aa

ID

ZDB-MRPHLNO-130222-2

Name

MO1-lrp1aa

Previous Names

None

Target

lrp1aa (1)

Sequence

5' - ATCGGTGTTCATACCAGAGGTGGAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-lrp1aa

No data available

Phenotype

Phenotype resulting from MO1-lrp1aa

Phenotype	Fish	Figures
blood circulation disrupted, abnormal	s843Tg + MO1-lrp1aa	Fig. S5, text only from Pi et al., 2012
caudal vein plexus decreased branchiness, abnormal	s843Tg + MO1-lrp1aa	Fig. 5, Fig. S5, text only from Pi et al., 2012
heart contraction decreased rate, abnormal	s843Tg + MO1-lrp1aa + MO4-tp53	text only from Pi et al., 2012
intersegmental vessel morphology, abnormal	s843Tg + MO1-lrp1aa	Fig. S5, text only from Pi et al., 2012
post-vent region wholly dorsalized, abnormal	s843Tg; sd2Tg + MO1-lrp1aa	Fig. S5 from Pi et al., 2012
trunk vasculature morphology, abnormal	s843Tg + MO1-lrp1aa	Fig. 5, Fig. S5, text only from Pi et al., 2012
vasculature morphology, abnormal	s843Tg + MO1-lrp1aa	Fig. 5 from Pi et al., 2012
vasculature development disrupted, abnormal	s843Tg + MO1-lrp1aa	Fig. 5, Fig. S5, text only from Pi et al., 2012

Phenotype of all Fish created by or utilizing MO1-lrp1aa

Phenotype	Fish	Conditions	Figures
heart contraction decreased rate, abnormal	s843Tg + MO1-lrp1aa	standard conditions	text only from Pi et al., 2012
vasculature morphology, abnormal	s843Tg + MO1-lrp1aa	standard conditions	Fig. 5 from Pi et al., 2012
intersegmental vessel morphology, abnormal	s843Tg + MO1-lrp1aa	standard conditions	text only from Pi et al., 2012
vasculature development disrupted, abnormal	s843Tg + MO1-lrp1aa	standard conditions	Fig. 5, Fig. S5, text only from Pi et al., 2012
blood circulation disrupted, abnormal	s843Tg + MO1-lrp1aa	standard conditions	text only from Pi et al., 2012
caudal vein plexus decreased branchiness, abnormal	s843Tg + MO1-lrp1aa	standard conditions	Fig. 5, Fig. S5, text only from Pi et al., 2012
trunk vasculature morphology, abnormal	s843Tg + MO1-lrp1aa	standard conditions	Fig. 5, Fig. S5, text only from Pi et al., 2012
intersegmental vessel morphology, abnormal	s843Tg + MO1-lrp1aa + MO4-tp53	standard conditions	text only from Pi et al., 2012
heart contraction decreased rate, abnormal	s843Tg + MO1-lrp1aa + MO4-tp53	standard conditions	text only from Pi et al., 2012
trunk vasculature morphology, abnormal	s843Tg + MO1-lrp1aa + MO4-tp53	standard conditions	text only from Pi et al., 2012
blood circulation disrupted, abnormal	s843Tg + MO1-lrp1aa + MO4-tp53	standard conditions	text only from Pi et al., 2012
vasculature development disrupted, abnormal	s843Tg + MO1-lrp1aa + MO4-tp53	standard conditions	text only from Pi et al., 2012
caudal vein plexus decreased branchiness, abnormal	s843Tg + MO1-lrp1aa + MO4-tp53	standard conditions	text only from Pi et al., 2012
blood circulation disrupted, abnormal	s843Tg; sd2Tg + MO1-lrp1aa	standard conditions	Fig. S5 from Pi et al., 2012
vasculature development disrupted, abnormal	s843Tg; sd2Tg + MO1-lrp1aa	standard conditions	Fig. S5 from Pi et al., 2012
trunk vasculature morphology, abnormal	s843Tg; sd2Tg + MO1-lrp1aa	standard conditions	Fig. S5 from Pi et al., 2012
post-vent region wholly dorsalized, abnormal	s843Tg; sd2Tg + MO1-lrp1aa	standard conditions	Fig. S5 from Pi et al., 2012
intersegmental vessel morphology, abnormal	s843Tg; sd2Tg + MO1-lrp1aa	standard conditions	Fig. S5 from Pi et al., 2012
trunk vasculature morphology, abnormal	s843Tg; sd2Tg + MO1-lrp1aa + MO4-tp53	standard conditions	Fig. S5 from Pi et al., 2012
vasculature development disrupted, abnormal	s843Tg; sd2Tg + MO1-lrp1aa + MO4-tp53	standard conditions	Fig. S5 from Pi et al., 2012
post-vent region wholly dorsalized, abnormal	s843Tg; sd2Tg + MO1-lrp1aa + MO4-tp53	standard conditions	Fig. S5 from Pi et al., 2012
intersegmental vessel morphology, abnormal	s843Tg; sd2Tg + MO1-lrp1aa + MO4-tp53	standard conditions	Fig. S5 from Pi et al., 2012
trunk vasculature morphology, abnormal	s843Tg + MO1-lrp1aa + MO1-lrp1ab	standard conditions	Fig. S5 from Pi et al., 2012
caudal vein plexus decreased branchiness, abnormal	s843Tg + MO1-lrp1aa + MO1-lrp1ab	standard conditions	Fig. S5 from Pi et al., 2012
vasculature development disrupted, abnormal	s843Tg + MO1-lrp1aa + MO1-lrp1ab	standard conditions	Fig. S5 from Pi et al., 2012

Citations