Morpholino

MO3-wnk1b

ID

ZDB-MRPHLNO-130220-5

Name

MO3-wnk1b

Previous Names

MO-hsn2-SB3 prime (1)

Target

wnk1b (1)

Sequence

5' - CGAGAACGAGTATTTCTAGGTACCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

splice-blocker morpholino targeted to the splice acceptor site of the hsn2 exon of the wnk1b gene.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-wnk1b

Expressed Gene	Anatomy	Figures
slc12a5b	whole organism	Fig. 4 from Bercier et al., 2013

Phenotype

Phenotype resulting from MO3-wnk1b

Phenotype	Fish	Figures
posterior lateral line development decreased process quality, abnormal	zf106Tg + MO3-wnk1b	Fig. 2 , Fig. 5 from Bercier et al., 2013
posterior lateral line neuromast has fewer parts of type neuromast hair cell, abnormal	zf106Tg + MO3-wnk1b	Fig. 2 , Fig. 3 , Fig. 4 from Bercier et al., 2013
posterior lateral line neuromast development decreased process quality, abnormal	WT + MO3-wnk1b	Fig. 3 , Fig. 4 from Bercier et al., 2013
posterior lateral line primordium decreased area, abnormal	zf106Tg + MO3-wnk1b	Fig. 5 from Bercier et al., 2013
potassium:chloride symporter activity increased process quality, abnormal	WT + MO3-wnk1b	Fig. 4 from Bercier et al., 2013

Phenotype of all Fish created by or utilizing MO3-wnk1b

Phenotype	Fish	Conditions	Figures
posterior lateral line neuromast development decreased process quality, abnormal	WT + MO3-wnk1b	standard conditions	Fig. 4 from Bercier et al., 2013
posterior lateral line development decreased process quality, abnormal	WT + MO3-wnk1b	standard conditions	Fig. 2 from Bercier et al., 2013
posterior lateral line neuromast has fewer parts of type neuromast hair cell, abnormal	WT + MO3-wnk1b	standard conditions	Fig. 2 , Fig. 4 from Bercier et al., 2013
potassium:chloride symporter activity increased process quality, abnormal	WT + MO3-wnk1b	standard conditions	Fig. 4 from Bercier et al., 2013
posterior lateral line neuromast has fewer parts of type neuromast hair cell, abnormal	mi2Tg + MO3-wnk1b	standard conditions	Fig. 3 from Bercier et al., 2013
posterior lateral line neuromast development decreased process quality, abnormal	mi2Tg + MO3-wnk1b	standard conditions	Fig. 3 from Bercier et al., 2013
posterior lateral line neuromast development decreased process quality, abnormal	zf106Tg + MO3-wnk1b	standard conditions	Fig. 3 from Bercier et al., 2013
posterior lateral line development decreased process quality, abnormal	zf106Tg + MO3-wnk1b	standard conditions	Fig. 5 from Bercier et al., 2013
posterior lateral line neuromast has fewer parts of type neuromast hair cell, abnormal	zf106Tg + MO3-wnk1b	standard conditions	Fig. 3 from Bercier et al., 2013
posterior lateral line primordium decreased area, abnormal	zf106Tg + MO3-wnk1b	standard conditions	Fig. 5 from Bercier et al., 2013
posterior lateral line neuromast has fewer parts of type neuromast hair cell, abnormal	WT + MO1-slc12a5b + MO3-wnk1b	standard conditions	Fig. 4 from Bercier et al., 2013
posterior lateral line neuromast development decreased process quality, abnormal	WT + MO1-slc12a5b + MO3-wnk1b	standard conditions	Fig. 4 from Bercier et al., 2013

Citations