Morpholino

MO1-auts2a

ID

ZDB-MRPHLNO-130212-6

Name

MO1-auts2a

Previous Names

None

Target

auts2a (1)

Sequence

5' - GTGGAGAGTGTGTCAACACTAAAAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-auts2a

No data available

Phenotype

Phenotype resulting from MO1-auts2a

Phenotype	Fish	Figures
apoptotic process increased occurrence, abnormal	WT + MO1-auts2a	Fig. S2 from Oksenberg et al., 2013
cell proliferation in forebrain increased occurrence, abnormal	WT + MO1-auts2a	Fig. 2 from Oksenberg et al., 2013
cell proliferation in hindbrain increased occurrence, abnormal	WT + MO1-auts2a	Fig. 2 from Oksenberg et al., 2013
cell proliferation in midbrain increased occurrence, abnormal	WT + MO1-auts2a	Fig. 2 from Oksenberg et al., 2013
cerebellum neuron decreased amount, abnormal	knu3Tg + MO1-auts2a	Fig. 2 from Oksenberg et al., 2013
eye decreased size, abnormal	WT + MO1-auts2a	Fig. 2 , Fig. S1 from Oksenberg et al., 2013
fin decreased size, abnormal	WT + MO1-auts2a	Fig. 2 , Fig. S1 from Oksenberg et al., 2013
head decreased size, abnormal	WT + MO1-auts2a	Fig. 2 , Fig. S1 from Oksenberg et al., 2013
motor neuron axon increased branchiness, abnormal	WT + MO1-auts2a	Fig. S3 from Oksenberg et al., 2013
motor neuron neuron projection decreased size, abnormal	ml2Tg + MO1-auts2a	Fig. 2 from Oksenberg et al., 2013
motor neuron neuron projection perpendicular to spinal cord, abnormal	ml2Tg + MO1-auts2a	Fig. 2 from Oksenberg et al., 2013
optic tectum neuron decreased amount, abnormal	knu3Tg + MO1-auts2a	Fig. 2 from Oksenberg et al., 2013
spinal cord motor neuron decreased amount, abnormal	ml2Tg + MO1-auts2a	Fig. 2 from Oksenberg et al., 2013
spinal cord Rohon-Beard neuron decreased amount, abnormal	WT + MO1-auts2a	Fig. 2 from Oksenberg et al., 2013
trunk decreased size, abnormal	WT + MO1-auts2a	Fig. 2 , Fig. S1 from Oksenberg et al., 2013

Phenotype of all Fish created by or utilizing MO1-auts2a

Phenotype	Fish	Conditions	Figures
head decreased size, abnormal	WT + MO1-auts2a	standard conditions	Fig. 2 , Fig. S1 from Oksenberg et al., 2013
fin decreased size, abnormal	WT + MO1-auts2a	standard conditions	Fig. 2 , Fig. S1 from Oksenberg et al., 2013
cell proliferation in forebrain increased occurrence, abnormal	WT + MO1-auts2a	standard conditions	Fig. 2 from Oksenberg et al., 2013
motor neuron axon increased branchiness, abnormal	WT + MO1-auts2a	standard conditions	Fig. S3 from Oksenberg et al., 2013
cell proliferation in midbrain increased occurrence, abnormal	WT + MO1-auts2a	standard conditions	Fig. 2 from Oksenberg et al., 2013
spinal cord Rohon-Beard neuron decreased amount, abnormal	WT + MO1-auts2a	standard conditions	Fig. 2 from Oksenberg et al., 2013
apoptotic process increased occurrence, abnormal	WT + MO1-auts2a	standard conditions	Fig. S2 from Oksenberg et al., 2013
eye decreased size, abnormal	WT + MO1-auts2a	standard conditions	Fig. 2 , Fig. S1 from Oksenberg et al., 2013
trunk decreased size, abnormal	WT + MO1-auts2a	standard conditions	Fig. 2 , Fig. S1 from Oksenberg et al., 2013
cell proliferation in hindbrain increased occurrence, abnormal	WT + MO1-auts2a	standard conditions	Fig. 2 from Oksenberg et al., 2013
cerebellum neuron decreased amount, abnormal	knu3Tg + MO1-auts2a	standard conditions	Fig. 2 from Oksenberg et al., 2013
optic tectum neuron decreased amount, abnormal	knu3Tg + MO1-auts2a	standard conditions	Fig. 2 from Oksenberg et al., 2013
motor neuron neuron projection perpendicular to spinal cord, abnormal	ml2Tg + MO1-auts2a	standard conditions	Fig. 2 from Oksenberg et al., 2013
spinal cord motor neuron decreased amount, abnormal	ml2Tg + MO1-auts2a	standard conditions	Fig. 2 from Oksenberg et al., 2013
motor neuron neuron projection decreased size, abnormal	ml2Tg + MO1-auts2a	standard conditions	Fig. 2 from Oksenberg et al., 2013

Citations