Morpholino

MO1-auts2a

ID
ZDB-MRPHLNO-130212-6
Name
MO1-auts2a
Previous Names
None
Target
Sequence
5' - GTGGAGAGTGTGTCAACACTAAAAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-auts2a
No data available
Phenotype
Phenotype resulting from MO1-auts2a
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO1-auts2a Fig. S2 with image from Oksenberg et al., 2013
cell proliferation in forebrain increased occurrence, abnormal WT + MO1-auts2a Fig. 2 with image from Oksenberg et al., 2013
cell proliferation in hindbrain increased occurrence, abnormal WT + MO1-auts2a Fig. 2 with image from Oksenberg et al., 2013
cell proliferation in midbrain increased occurrence, abnormal WT + MO1-auts2a Fig. 2 with image from Oksenberg et al., 2013
cerebellum neuron decreased amount, abnormal knu3Tg + MO1-auts2a Fig. 2 with image from Oksenberg et al., 2013
eye decreased size, abnormal WT + MO1-auts2a Fig. 2 with imageFig. S1 with image from Oksenberg et al., 2013
fin decreased size, abnormal WT + MO1-auts2a Fig. 2 with imageFig. S1 with image from Oksenberg et al., 2013
head decreased size, abnormal WT + MO1-auts2a Fig. 2 with imageFig. S1 with image from Oksenberg et al., 2013
motor neuron axon increased branchiness, abnormal WT + MO1-auts2a Fig. S3 with image from Oksenberg et al., 2013
motor neuron neuron projection decreased size, abnormal ml2Tg + MO1-auts2a Fig. 2 with image from Oksenberg et al., 2013
motor neuron neuron projection perpendicular to spinal cord, abnormal ml2Tg + MO1-auts2a Fig. 2 with image from Oksenberg et al., 2013
optic tectum neuron decreased amount, abnormal knu3Tg + MO1-auts2a Fig. 2 with image from Oksenberg et al., 2013
spinal cord motor neuron decreased amount, abnormal ml2Tg + MO1-auts2a Fig. 2 with image from Oksenberg et al., 2013
spinal cord Rohon-Beard neuron decreased amount, abnormal WT + MO1-auts2a Fig. 2 with image from Oksenberg et al., 2013
trunk decreased size, abnormal WT + MO1-auts2a Fig. 2 with imageFig. S1 with image from Oksenberg et al., 2013
Phenotype of all Fish created by or utilizing MO1-auts2a
Phenotype Fish Conditions Figures
head decreased size, abnormal WT + MO1-auts2a standard conditions Fig. 2 with imageFig. S1 with image from Oksenberg et al., 2013
fin decreased size, abnormal WT + MO1-auts2a standard conditions Fig. 2 with imageFig. S1 with image from Oksenberg et al., 2013
cell proliferation in forebrain increased occurrence, abnormal WT + MO1-auts2a standard conditions Fig. 2 with image from Oksenberg et al., 2013
motor neuron axon increased branchiness, abnormal WT + MO1-auts2a standard conditions Fig. S3 with image from Oksenberg et al., 2013
cell proliferation in midbrain increased occurrence, abnormal WT + MO1-auts2a standard conditions Fig. 2 with image from Oksenberg et al., 2013
spinal cord Rohon-Beard neuron decreased amount, abnormal WT + MO1-auts2a standard conditions Fig. 2 with image from Oksenberg et al., 2013
apoptotic process increased occurrence, abnormal WT + MO1-auts2a standard conditions Fig. S2 with image from Oksenberg et al., 2013
eye decreased size, abnormal WT + MO1-auts2a standard conditions Fig. 2 with imageFig. S1 with image from Oksenberg et al., 2013
trunk decreased size, abnormal WT + MO1-auts2a standard conditions Fig. 2 with imageFig. S1 with image from Oksenberg et al., 2013
cell proliferation in hindbrain increased occurrence, abnormal WT + MO1-auts2a standard conditions Fig. 2 with image from Oksenberg et al., 2013
cerebellum neuron decreased amount, abnormal knu3Tg + MO1-auts2a standard conditions Fig. 2 with image from Oksenberg et al., 2013
optic tectum neuron decreased amount, abnormal knu3Tg + MO1-auts2a standard conditions Fig. 2 with image from Oksenberg et al., 2013
motor neuron neuron projection perpendicular to spinal cord, abnormal ml2Tg + MO1-auts2a standard conditions Fig. 2 with image from Oksenberg et al., 2013
spinal cord motor neuron decreased amount, abnormal ml2Tg + MO1-auts2a standard conditions Fig. 2 with image from Oksenberg et al., 2013
motor neuron neuron projection decreased size, abnormal ml2Tg + MO1-auts2a standard conditions Fig. 2 with image from Oksenberg et al., 2013
Citations