Morpholino

MO3-antxr2a

ID

ZDB-MRPHLNO-130206-3

Name

MO3-antxr2a

Previous Names

UTR morpholino (1)

Target

antxr2a (1)

Sequence

5' - CGCGGATCAAAAATAATAAGAGAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO, targets the 5'UTR.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-antxr2a

No data available

Phenotype

Phenotype resulting from MO3-antxr2a

Phenotype	Fish	Figures
anterior neural plate increased width, abnormal	WT + MO3-antxr2a	Fig. S7 from Castanon et al., 2013
convergent extension disrupted, abnormal	WT + MO3-antxr2a	Fig. S7 from Castanon et al., 2013
epiblast actin cap position, abnormal	WT + MO3-antxr2a	Fig. 5 from Castanon et al., 2013
epiblast mitotic spindle position, abnormal	kca66Tg; kca6Tg + MO3-antxr2a	Fig. 2, Fig. 5 from Castanon et al., 2013
establishment of mitotic spindle orientation disrupted, abnormal	WT + MO3-antxr2a	Fig. 2, Fig. 5 from Castanon et al., 2013
notochord decreased length, abnormal	WT + MO3-antxr2a	Fig. S7 from Castanon et al., 2013
notochord increased width, abnormal	WT + MO3-antxr2a	Fig. S7 from Castanon et al., 2013
prechordal plate elongated, abnormal	WT + MO3-antxr2a	Fig. S7 from Castanon et al., 2013
whole organism decreased length, abnormal	WT + MO3-antxr2a	Fig. 7 from Castanon et al., 2013

Phenotype of all Fish created by or utilizing MO3-antxr2a

Phenotype	Fish	Conditions	Figures
prechordal plate elongated, abnormal	WT + MO3-antxr2a	standard conditions	Fig. S7 from Castanon et al., 2013
establishment of mitotic spindle orientation disrupted, abnormal	WT + MO3-antxr2a	standard conditions	Fig. 5 from Castanon et al., 2013
notochord decreased length, abnormal	WT + MO3-antxr2a	standard conditions	Fig. S7 from Castanon et al., 2013
epiblast actin cap position, abnormal	WT + MO3-antxr2a	standard conditions	Fig. 5 from Castanon et al., 2013
whole organism decreased length, abnormal	WT + MO3-antxr2a	standard conditions	Fig. 7 from Castanon et al., 2013
convergent extension disrupted, abnormal	WT + MO3-antxr2a	standard conditions	Fig. S7 from Castanon et al., 2013
notochord increased width, abnormal	WT + MO3-antxr2a	standard conditions	Fig. S7 from Castanon et al., 2013
epiblast mitotic spindle position, abnormal	WT + MO3-antxr2a	standard conditions	Fig. 5 from Castanon et al., 2013
anterior neural plate increased width, abnormal	WT + MO3-antxr2a	standard conditions	Fig. S7 from Castanon et al., 2013
establishment of mitotic spindle orientation disrupted, abnormal	kca66Tg; kca6Tg + MO3-antxr2a	standard conditions	Fig. 2 from Castanon et al., 2013
epiblast mitotic spindle position, abnormal	kca66Tg; kca6Tg + MO3-antxr2a	standard conditions	Fig. 2 from Castanon et al., 2013
notochord decreased length, abnormal	WT + MO1-gpc4 + MO3-antxr2a	standard conditions	Fig. S7 from Castanon et al., 2013
prechordal plate elongated, abnormal	WT + MO1-gpc4 + MO3-antxr2a	standard conditions	Fig. S7 from Castanon et al., 2013
convergent extension disrupted, abnormal	WT + MO1-gpc4 + MO3-antxr2a	standard conditions	Fig. S7 from Castanon et al., 2013
whole organism decreased length, abnormal	WT + MO1-gpc4 + MO3-antxr2a	standard conditions	Fig. S7 from Castanon et al., 2013
notochord increased width, abnormal	WT + MO1-gpc4 + MO3-antxr2a	standard conditions	Fig. S7 from Castanon et al., 2013
anterior neural plate increased width, abnormal	WT + MO1-gpc4 + MO3-antxr2a	standard conditions	Fig. S7 from Castanon et al., 2013
anterior neural plate increased width, abnormal	WT + MO1-wnt5b + MO3-antxr2a	standard conditions	Fig. S7 from Castanon et al., 2013
convergent extension disrupted, abnormal	WT + MO1-wnt5b + MO3-antxr2a	standard conditions	Fig. S7 from Castanon et al., 2013
notochord decreased length, abnormal	WT + MO1-wnt5b + MO3-antxr2a	standard conditions	Fig. S7 from Castanon et al., 2013
notochord increased width, abnormal	WT + MO1-wnt5b + MO3-antxr2a	standard conditions	Fig. S7 from Castanon et al., 2013
prechordal plate elongated, abnormal	WT + MO1-wnt5b + MO3-antxr2a	standard conditions	Fig. S7 from Castanon et al., 2013
whole organism decreased length, abnormal	WT + MO1-wnt5b + MO3-antxr2a	standard conditions	Fig. S7 from Castanon et al., 2013

Citations