Morpholino

MO3-crispld2

ID
ZDB-MRPHLNO-130131-3
Name
MO3-crispld2
Previous Names
None
Target
Sequence
5' - TTGATGATTTCAGGCCCGGACTCTA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-crispld2
No data available
Phenotype
Phenotype resulting from MO3-crispld2
Phenotype Fish Figures
embryo development disrupted, abnormal WT + MO3-crispld2 Fig. 3 from Yuan et al., 2012
embryonic viscerocranium morphogenesis decreased process quality, abnormal ba2Tg + MO3-crispld2 Fig. 2 with image from Swindell et al., 2015
ethmoid cartilage absent, abnormal WT + MO3-crispld2 Fig. 4 from Yuan et al., 2012
head apoptotic process increased occurrence, abnormal WT + MO3-crispld2 + MO4-tp53 Fig. 3 with image from Swindell et al., 2015
heart edematous, abnormal WT + MO3-crispld2 Fig. 3 from Yuan et al., 2012
hypophyseal fenestra absent, abnormal WT + MO3-crispld2 Fig. 4 from Yuan et al., 2012
neural crest cell migration process quality, abnormal ba2Tg + MO3-crispld2 Fig. 1 with image from Swindell et al., 2015
neurocranial trabecula decreased size, abnormal WT + MO3-crispld2 Fig. 4 from Yuan et al., 2012
neurocranial trabecula malformed, abnormal WT + MO3-crispld2 Fig. 4 from Yuan et al., 2012
palate malformed, abnormal WT + MO3-crispld2 Fig. 4,  Fig. 5 from Yuan et al., 2012
pharyngeal arch 3-7 cell population proliferation decreased occurrence, abnormal WT + MO3-crispld2 Fig. 4 with image from Swindell et al., 2015
pharyngeal arch cartilage malformed, abnormal ba2Tg + MO3-crispld2 Fig. 2 with image from Swindell et al., 2015
post-vent region curved, abnormal WT + MO3-crispld2 Fig. 3 from Yuan et al., 2012
post-vent region shortened, abnormal WT + MO3-crispld2 Fig. 3 from Yuan et al., 2012
trunk truncated, abnormal WT + MO3-crispld2 Fig. 3 from Yuan et al., 2012
ventral mandibular arch absent, abnormal WT + MO3-crispld2 Fig. 4,  Fig. 5 from Yuan et al., 2012
whole organism decreased life span, abnormal WT + MO3-crispld2 Fig. 3 from Yuan et al., 2012
whole organism has fewer parts of type neural crest cell, abnormal ba2Tg + MO3-crispld2 Fig. 1 with image from Swindell et al., 2015
whole organism fosab expression increased amount, abnormal WT + MO3-crispld2 Fig. 1 from Chiquet et al., 2018
whole organism mmp2 expression increased amount, abnormal WT + MO3-crispld2 Fig. 1 from Chiquet et al., 2018
Fig. 6 with image from Swindell et al., 2015
whole organism casp8 expression increased amount, abnormal WT + MO3-crispld2 Fig. 1 from Chiquet et al., 2018
Fig. 6 with image from Swindell et al., 2015
Phenotype of all Fish created by or utilizing MO3-crispld2
Phenotype Fish Conditions Figures
neurocranial trabecula malformed, abnormal WT + MO3-crispld2 standard conditions Fig. 4 from Yuan et al., 2012
ventral mandibular arch absent, abnormal WT + MO3-crispld2 standard conditions Fig. 4,  Fig. 5 from Yuan et al., 2012
neurocranial trabecula decreased size, abnormal WT + MO3-crispld2 standard conditions Fig. 4 from Yuan et al., 2012
whole organism fosab expression increased amount, abnormal WT + MO3-crispld2 standard conditions Fig. 1 from Chiquet et al., 2018
trunk truncated, abnormal WT + MO3-crispld2 standard conditions Fig. 3 from Yuan et al., 2012
whole organism mmp2 expression increased amount, abnormal WT + MO3-crispld2 standard conditions Fig. 1 from Chiquet et al., 2018
Fig. 6 with image from Swindell et al., 2015
hypophyseal fenestra absent, abnormal WT + MO3-crispld2 standard conditions Fig. 4 from Yuan et al., 2012
whole organism decreased life span, abnormal WT + MO3-crispld2 standard conditions Fig. 3 from Yuan et al., 2012
post-vent region shortened, abnormal WT + MO3-crispld2 standard conditions Fig. 3 from Yuan et al., 2012
head apoptotic process increased occurrence, abnormal WT + MO3-crispld2 standard conditions Fig. 3 with image from Swindell et al., 2015
heart edematous, abnormal WT + MO3-crispld2 standard conditions Fig. 3 from Yuan et al., 2012
post-vent region curved, abnormal WT + MO3-crispld2 standard conditions Fig. 3 from Yuan et al., 2012
embryo development disrupted, abnormal WT + MO3-crispld2 standard conditions Fig. 3 from Yuan et al., 2012
ethmoid cartilage absent, abnormal WT + MO3-crispld2 standard conditions Fig. 4 from Yuan et al., 2012
whole organism casp8 expression increased amount, abnormal WT + MO3-crispld2 standard conditions Fig. 1 from Chiquet et al., 2018
Fig. 6 with image from Swindell et al., 2015
pharyngeal arch 3-7 cell population proliferation decreased occurrence, abnormal WT + MO3-crispld2 standard conditions Fig. 4 with image from Swindell et al., 2015
palate malformed, abnormal WT + MO3-crispld2 standard conditions Fig. 4,  Fig. 5 from Yuan et al., 2012
head apoptotic process increased occurrence, abnormal WT + MO3-crispld2 + MO4-tp53 standard conditions Fig. 3 with image from Swindell et al., 2015
neural crest cell migration process quality, abnormal ba2Tg + MO3-crispld2 standard conditions Fig. 1 with image from Swindell et al., 2015
whole organism has fewer parts of type neural crest cell, abnormal ba2Tg + MO3-crispld2 standard conditions Fig. 1 with image from Swindell et al., 2015
pharyngeal arch cartilage malformed, abnormal ba2Tg + MO3-crispld2 standard conditions Fig. 2 with image from Swindell et al., 2015
embryonic viscerocranium morphogenesis decreased process quality, abnormal ba2Tg + MO3-crispld2 standard conditions Fig. 2 with image from Swindell et al., 2015
Citations