Morpholino
MO1-oprd1b
- ID
- ZDB-MRPHLNO-130123-2
- Name
- MO1-oprd1b
- Previous Names
-
- ZfDOR2 (1)
- Target
- Sequence
-
5' - GGAGGCTCCATTATGCTCGTCCCCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-oprd1b
Expressed Gene | Anatomy | Figures |
---|---|---|
oprd1b |
Fig. 4 ![]() |
1 - 1 of 1
Phenotype
Phenotype resulting from MO1-oprd1b
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-oprd1b
1 - 2 of 2
Citations
- Arévalo, J.C., Hernández-Jiménez, E., Jiménez-González, A., Torres-Valle, M., Iwasaki, R.S., López-Bellido, R., Vicente-García, C., Rodríguez, R.E. (2018) Generation and Characterization of Antibodies against Opioid Receptors from Zebrafish. International Journal of Molecular Sciences. 19(1)
- López-Bellido, R., Barreto-Valer, K., and Rodriguez, R.E. (2013) Expression of tachykinin receptors in zebrafish: influence of cocaine and opioid receptors. Journal of molecular endocrinology. 50(2):115-129
- López-Bellido, R., Barreto-Valer, K., and Rodríguez, R.E. (2013) Substance P mRNA expression during zebrafish development: Influence of mu opioid receptor and cocaine. Neuroscience. 242:53-68
- López-Bellido, R., Barreto-Valer, K., Sánchez-Simón, F.M., and Rodríguez, R.E. (2012) Cocaine Modulates the Expression of Opioid Receptors and miR-let-7d in Zebrafish Embryos. PLoS One. 7(11):e50885
1 - 4 of 4
Show