Morpholino

MO2-wtip

ID
ZDB-MRPHLNO-130117-3
Name
MO2-wtip
Previous Names
None
Target
Sequence
5' - GATCCTCGTCGTATTCATCCATGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wtip
No data available
Phenotype
Phenotype resulting from MO2-wtip
Phenotype Fish Figures
atrial myocardium decreased thickness, abnormal AB + MO2-wtip Fig. 6 with image from Powell et al., 2016
atrial myocardium separated from ventricular myocardium, abnormal AB + MO2-wtip Fig. 6 with image from Powell et al., 2016
atrial myocardium separated from ventricular endocardium, abnormal AB + MO2-wtip Fig. 6 with image from Powell et al., 2016
atrioventricular canal nppa expression mislocalised, abnormal AB + MO2-wtip Fig. 5 with image from Powell et al., 2016
atrioventricular canal cell morphology, abnormal AB + MO2-wtip Fig. 6 with image from Powell et al., 2016
atrioventricular canal development decreased process quality, abnormal AB + MO2-wtip Fig. 5 with image from Powell et al., 2016
atrioventricular valve development decreased occurrence, abnormal AB + MO2-wtip Fig. 6 with image from Powell et al., 2016
brain hydrocephalic, abnormal AB + MO2-wtip Fig. 2 with image from Bubenshchikova et al., 2012
ciliated cell ciliary rootlet absent, abnormal AB + MO2-wtip Fig. 4 with image from Bubenshchikova et al., 2012
ciliated cell mitotic spindle increased angle to pronephros apical-basal axis relative to substrate, abnormal AB + MO2-wtip Fig. 6 with image from Bubenshchikova et al., 2012
cloacal chamber malformed, abnormal AB + MO2-wtip Fig. 2 with image from Bubenshchikova et al., 2012
cloacal chamber ciliated cell decreased amount, abnormal AB + MO2-wtip Fig. 4 with image from Bubenshchikova et al., 2012
determination of heart left/right asymmetry decreased occurrence, abnormal AB + MO2-wtip Fig. 7 with image from Powell et al., 2016
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal AB + MO2-wtip Fig. 7 with image from Powell et al., 2016
endocardial cushion absent, abnormal AB + MO2-wtip Fig. 6 with image from Powell et al., 2016
establishment of mitotic spindle orientation disrupted, abnormal AB + MO2-wtip Fig. 6 with image from Bubenshchikova et al., 2012
heart looping decreased occurrence, abnormal f1Tg + MO2-wtip Fig. 5 with image from Powell et al., 2016
heart rudiment right side bmp4 expression mislocalised, abnormal AB + MO2-wtip Fig. 7 with image from Powell et al., 2016
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO2-wtip Fig. 7 with image from Powell et al., 2016
lateral plate mesoderm right side lft1 expression mislocalised, abnormal AB + MO2-wtip Fig. 7 with image from Powell et al., 2016
pericardium edematous, abnormal AB + MO2-wtip Fig. 2 with image from Bubenshchikova et al., 2012
proepicardial cluster tcf21 expression decreased amount, abnormal AB + MO2-wtip Fig. 2 with imageFig. 4 with image from Powell et al., 2016
proepicardial cluster tbx18 expression decreased amount, abnormal AB + MO2-wtip Fig. 2 with imageFig. 4 with image from Powell et al., 2016
proepicardial cluster ciliary basal body wtip expression absent, abnormal AB + MO2-wtip Fig. 1 with image from Powell et al., 2016
pronephric glomerulus cystic, abnormal AB + MO2-wtip Fig. 2 with image from Bubenshchikova et al., 2012
pronephros cystic, abnormal AB + MO2-wtip Fig. 2 with image from Bubenshchikova et al., 2012
pronephros anterior region dilated, abnormal AB + MO2-wtip Fig. 2 with image from Bubenshchikova et al., 2012
pronephros ciliated cell decreased amount, abnormal AB + MO2-wtip Fig. 4 with image from Bubenshchikova et al., 2012
pronephros motile cilium immobile, abnormal AB + MO2-wtip Fig. SMovie 2 from Bubenshchikova et al., 2012
trunk curved, abnormal AB + MO2-wtip Fig. 2 with image from Bubenshchikova et al., 2012
Phenotype of all Fish created by or utilizing MO2-wtip
Phenotype Fish Conditions Figures
cloacal chamber malformed, abnormal AB + MO2-wtip standard conditions Fig. 2 with image from Bubenshchikova et al., 2012
endocardial cushion absent, abnormal AB + MO2-wtip control Fig. 6 with image from Powell et al., 2016
ciliated cell ciliary rootlet absent, abnormal AB + MO2-wtip standard conditions Fig. 4 with image from Bubenshchikova et al., 2012
atrioventricular valve development decreased occurrence, abnormal AB + MO2-wtip control Fig. 6 with image from Powell et al., 2016
atrioventricular canal nppa expression mislocalised, abnormal AB + MO2-wtip control Fig. 5 with image from Powell et al., 2016
pronephric glomerulus cystic, abnormal AB + MO2-wtip standard conditions Fig. 2 with image from Bubenshchikova et al., 2012
pronephros anterior region dilated, abnormal AB + MO2-wtip standard conditions Fig. 2 with image from Bubenshchikova et al., 2012
lateral plate mesoderm right side lft1 expression mislocalised, abnormal AB + MO2-wtip control Fig. 7 with image from Powell et al., 2016
trunk curved, abnormal AB + MO2-wtip standard conditions Fig. 2 with image from Bubenshchikova et al., 2012
proepicardial cluster tbx18 expression decreased amount, abnormal AB + MO2-wtip control Fig. 2 with imageFig. 4 with image from Powell et al., 2016
brain hydrocephalic, abnormal AB + MO2-wtip standard conditions Fig. 2 with image from Bubenshchikova et al., 2012
heart looping decreased occurrence, abnormal AB + MO2-wtip control Fig. 5 with image from Powell et al., 2016
atrioventricular canal cell morphology, abnormal AB + MO2-wtip control Fig. 6 with image from Powell et al., 2016
atrial myocardium separated from ventricular myocardium, abnormal AB + MO2-wtip control Fig. 6 with image from Powell et al., 2016
pronephros motile cilium immobile, abnormal AB + MO2-wtip standard conditions Fig. SMovie 2 from Bubenshchikova et al., 2012
ciliated cell mitotic spindle increased angle to pronephros apical-basal axis relative to substrate, abnormal AB + MO2-wtip standard conditions Fig. 6 with image from Bubenshchikova et al., 2012
determination of heart left/right asymmetry decreased occurrence, abnormal AB + MO2-wtip control Fig. 7 with image from Powell et al., 2016
heart rudiment right side bmp4 expression mislocalised, abnormal AB + MO2-wtip control Fig. 7 with image from Powell et al., 2016
pericardium edematous, abnormal AB + MO2-wtip standard conditions Fig. 2 with image from Bubenshchikova et al., 2012
atrioventricular canal development decreased process quality, abnormal AB + MO2-wtip control Fig. 5 with image from Powell et al., 2016
proepicardial cluster ciliary basal body wtip expression absent, abnormal AB + MO2-wtip control Fig. 1 with image from Powell et al., 2016
atrial myocardium separated from ventricular endocardium, abnormal AB + MO2-wtip control Fig. 6 with image from Powell et al., 2016
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO2-wtip control Fig. 7 with image from Powell et al., 2016
cloacal chamber ciliated cell decreased amount, abnormal AB + MO2-wtip standard conditions Fig. 4 with image from Bubenshchikova et al., 2012
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal AB + MO2-wtip control Fig. 7 with image from Powell et al., 2016
pronephros ciliated cell decreased amount, abnormal AB + MO2-wtip standard conditions Fig. 4 with image from Bubenshchikova et al., 2012
proepicardial cluster tcf21 expression decreased amount, abnormal AB + MO2-wtip control Fig. 2 with imageFig. 4 with image from Powell et al., 2016
atrial myocardium decreased thickness, abnormal AB + MO2-wtip control Fig. 6 with image from Powell et al., 2016
establishment of mitotic spindle orientation disrupted, abnormal AB + MO2-wtip standard conditions Fig. 6 with image from Bubenshchikova et al., 2012
pronephros cystic, abnormal AB + MO2-wtip standard conditions Fig. 2 with image from Bubenshchikova et al., 2012
heart looping decreased occurrence, abnormal f1Tg + MO2-wtip control Fig. 5 with image from Powell et al., 2016
pronephros ciliated cell decreased amount, abnormal AB + MO2-wtip + MO3-vangl2 standard conditions Fig. 5 with image from Bubenshchikova et al., 2012
establishment of mitotic spindle orientation disrupted, abnormal AB + MO2-wtip + MO3-vangl2 standard conditions Fig. 6 with image from Bubenshchikova et al., 2012
ciliated cell cilium decreased length, abnormal AB + MO2-wtip + MO3-vangl2 standard conditions Fig. 5 with image from Bubenshchikova et al., 2012
ciliated cell mitotic spindle increased angle to pronephros apical-basal axis relative to substrate, abnormal AB + MO2-wtip + MO3-vangl2 standard conditions Fig. 6 with image from Bubenshchikova et al., 2012
cloacal chamber ciliated cell decreased amount, abnormal AB + MO2-wtip + MO3-vangl2 standard conditions Fig. 5 with image from Bubenshchikova et al., 2012
proepicardial cluster tbx18 expression absent, abnormal AB + MO2-wtip + MO4-wt1a control Fig. 4 with image from Powell et al., 2016
proepicardial cluster tcf21 expression absent, abnormal AB + MO2-wtip + MO4-wt1a control Fig. 4 with image from Powell et al., 2016
Citations