Morpholino

MO1-atxn7

ID
ZDB-MRPHLNO-130114-2
Name
MO1-atxn7
Previous Names
  • MO zatxn7 AUG (1)
Target
Sequence
5' - CGTCATCATCGGCCCTTTCCGACAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-atxn7
Phenotype
Phenotype resulting from MO1-atxn7
Phenotype Fish Figures
camera-type eye photoreceptor cell differentiation disrupted, abnormal AB + MO1-atxn7 Fig. 8 from Carrillo-Rosas et al., 2018
cranial nerve II misrouted, abnormal cu2Tg; jh1Tg; q20Tg + MO1-atxn7 Fig. 7 from Carrillo-Rosas et al., 2018
cranial nerve II axon guidance disrupted, abnormal cu2Tg; jh1Tg; q20Tg + MO1-atxn7 Fig. 7 from Carrillo-Rosas et al., 2018
cranial nerve II axonal fasciculation disrupted, abnormal cu2Tg; jh1Tg; q20Tg + MO1-atxn7 Fig. 7 from Carrillo-Rosas et al., 2018
diencephalon shha expression increased amount, abnormal AB + MO1-atxn7 Fig. 6 from Carrillo-Rosas et al., 2018
diencephalon pax6a expression mislocalised, abnormal AB + MO1-atxn7 Fig. 6 from Carrillo-Rosas et al., 2018
embryo development disrupted, abnormal AB + MO1-atxn7 Fig. 3 with image from Yanicostas et al., 2012
eye decreased diameter, abnormal AB + MO1-atxn7 text only from Carrillo-Rosas et al., 2018
floor plate shhb expression increased amount, abnormal AB + MO1-atxn7 Fig. 6 from Carrillo-Rosas et al., 2018
forebrain ventral region shhb expression increased amount, abnormal AB + MO1-atxn7 Fig. 6 from Carrillo-Rosas et al., 2018
histone modification disrupted, abnormal AB + MO1-atxn7 text only from Carrillo-Rosas et al., 2018
optic cup unfused from optic cup, abnormal AB + MO1-atxn7 Fig. 2 from Carrillo-Rosas et al., 2018
optic cup ventral region vax2 expression increased distribution, abnormal AB + MO1-atxn7 Fig. 6 from Carrillo-Rosas et al., 2018
optic fissure closure incomplete, abnormal AB + MO1-atxn7 Fig. 2 from Carrillo-Rosas et al., 2018
optic fissure open, abnormal AB + MO1-atxn7 Fig. 3 from Carrillo-Rosas et al., 2018
optic nerve head fasciculation, abnormal cu2Tg; jh1Tg; q20Tg + MO1-atxn7 Fig. 7 from Carrillo-Rosas et al., 2018
optic stalk pax2a expression increased distribution, abnormal AB + MO1-atxn7 Fig. 6 from Carrillo-Rosas et al., 2018
optic vesicle pax2a expression mislocalised, abnormal AB + MO1-atxn7 Fig. 6 from Carrillo-Rosas et al., 2018
optic vesicle posterior region pax6a expression mislocalised, abnormal AB + MO1-atxn7 Fig. 6 from Carrillo-Rosas et al., 2018
photoreceptor cell photoreceptor inner segment malformed, abnormal AB + MO1-atxn7 Fig. 8 from Carrillo-Rosas et al., 2018
photoreceptor cell photoreceptor outer segment absent, abnormal AB + MO1-atxn7 Fig. 8 from Carrillo-Rosas et al., 2018
photoreceptor cell photoreceptor outer segment decreased length, abnormal AB + MO1-atxn7 Fig. 8 from Carrillo-Rosas et al., 2018
posterior segment eye proximal side irregularly shaped, abnormal AB + MO1-atxn7 Fig. 2 from Carrillo-Rosas et al., 2018
posterior segment eye proximal side lacks parts or has fewer parts of type retinal pigmented epithelium, abnormal AB + MO1-atxn7 Fig. 2 from Carrillo-Rosas et al., 2018
retina crx expression decreased distribution, abnormal AB + MO1-atxn7 Fig. 8 from Carrillo-Rosas et al., 2018
retina crx expression spatial pattern, abnormal AB + MO1-atxn7 Fig. 8 from Carrillo-Rosas et al., 2018
retinal neural layer protruding into brain, abnormal AB + MO1-atxn7 Fig. 3 from Carrillo-Rosas et al., 2018
retinal pigmented epithelium decreased area, abnormal AB + MO1-atxn7 Fig. 2 from Carrillo-Rosas et al., 2018
retinal pigmented epithelium decreased pigmentation, abnormal AB + MO1-atxn7 Fig. 8 from Carrillo-Rosas et al., 2018
somite morphology, abnormal AB + MO1-atxn7 text only from Carrillo-Rosas et al., 2018
telencephalon vax2 expression mislocalised, abnormal AB + MO1-atxn7 Fig. 6 from Carrillo-Rosas et al., 2018
whole organism dead, abnormal AB + MO1-atxn7 Fig. 3 with image from Yanicostas et al., 2012
whole organism decreased length, abnormal AB + MO1-atxn7 text only from Carrillo-Rosas et al., 2018
whole organism deformed, abnormal AB + MO1-atxn7 Fig. 3 with image from Yanicostas et al., 2012
Phenotype of all Fish created by or utilizing MO1-atxn7
Phenotype Fish Conditions Figures
optic vesicle pax2a expression mislocalised, abnormal AB + MO1-atxn7 control Fig. 6 from Carrillo-Rosas et al., 2018
optic vesicle posterior region pax6a expression mislocalised, abnormal AB + MO1-atxn7 control Fig. 6 from Carrillo-Rosas et al., 2018
optic cup ventral region vax2 expression increased distribution, abnormal AB + MO1-atxn7 control Fig. 6 from Carrillo-Rosas et al., 2018
retina crx expression spatial pattern, abnormal AB + MO1-atxn7 standard conditions Fig. 8 from Carrillo-Rosas et al., 2018
whole organism decreased length, abnormal AB + MO1-atxn7 standard conditions text only from Carrillo-Rosas et al., 2018
forebrain ventral region shhb expression increased amount, abnormal AB + MO1-atxn7 control Fig. 6 from Carrillo-Rosas et al., 2018
embryo development disrupted, abnormal AB + MO1-atxn7 standard conditions Fig. 3 with image from Yanicostas et al., 2012
optic cup unfused from optic cup, abnormal AB + MO1-atxn7 control Fig. 2 from Carrillo-Rosas et al., 2018
retinal neural layer protruding into brain, abnormal AB + MO1-atxn7 control Fig. 3 from Carrillo-Rosas et al., 2018
retinal pigmented epithelium decreased area, abnormal AB + MO1-atxn7 control Fig. 2 from Carrillo-Rosas et al., 2018
somite morphology, abnormal AB + MO1-atxn7 standard conditions text only from Carrillo-Rosas et al., 2018
whole organism deformed, abnormal AB + MO1-atxn7 standard conditions Fig. 3 with image from Yanicostas et al., 2012
whole organism dead, abnormal AB + MO1-atxn7 standard conditions Fig. 3 with image from Yanicostas et al., 2012
photoreceptor cell photoreceptor outer segment decreased length, abnormal AB + MO1-atxn7 standard conditions Fig. 8 from Carrillo-Rosas et al., 2018
camera-type eye photoreceptor cell differentiation disrupted, abnormal AB + MO1-atxn7 standard conditions Fig. 8 from Carrillo-Rosas et al., 2018
posterior segment eye proximal side irregularly shaped, abnormal AB + MO1-atxn7 control Fig. 2 from Carrillo-Rosas et al., 2018
eye decreased diameter, abnormal AB + MO1-atxn7 standard conditions text only from Carrillo-Rosas et al., 2018
optic fissure open, abnormal AB + MO1-atxn7 control Fig. 3 from Carrillo-Rosas et al., 2018
diencephalon pax6a expression mislocalised, abnormal AB + MO1-atxn7 control Fig. 6 from Carrillo-Rosas et al., 2018
retinal pigmented epithelium decreased pigmentation, abnormal AB + MO1-atxn7 standard conditions Fig. 8 from Carrillo-Rosas et al., 2018
telencephalon vax2 expression mislocalised, abnormal AB + MO1-atxn7 control Fig. 6 from Carrillo-Rosas et al., 2018
posterior segment eye proximal side lacks parts or has fewer parts of type retinal pigmented epithelium, abnormal AB + MO1-atxn7 control Fig. 2 from Carrillo-Rosas et al., 2018
diencephalon shha expression increased amount, abnormal AB + MO1-atxn7 control Fig. 6 from Carrillo-Rosas et al., 2018
histone modification disrupted, abnormal AB + MO1-atxn7 standard conditions text only from Carrillo-Rosas et al., 2018
floor plate shhb expression increased amount, abnormal AB + MO1-atxn7 control Fig. 6 from Carrillo-Rosas et al., 2018
retina crx expression decreased distribution, abnormal AB + MO1-atxn7 standard conditions Fig. 8 from Carrillo-Rosas et al., 2018
photoreceptor cell photoreceptor inner segment malformed, abnormal AB + MO1-atxn7 standard conditions Fig. 8 from Carrillo-Rosas et al., 2018
optic fissure closure incomplete, abnormal AB + MO1-atxn7 control Fig. 2 from Carrillo-Rosas et al., 2018
optic stalk pax2a expression increased distribution, abnormal AB + MO1-atxn7 control Fig. 6 from Carrillo-Rosas et al., 2018
photoreceptor cell photoreceptor outer segment absent, abnormal AB + MO1-atxn7 standard conditions Fig. 8 from Carrillo-Rosas et al., 2018
optic nerve head fasciculation, abnormal cu2Tg; jh1Tg; q20Tg + MO1-atxn7 standard conditions Fig. 7 from Carrillo-Rosas et al., 2018
cranial nerve II axon guidance disrupted, abnormal cu2Tg; jh1Tg; q20Tg + MO1-atxn7 standard conditions Fig. 7 from Carrillo-Rosas et al., 2018
cranial nerve II misrouted, abnormal cu2Tg; jh1Tg; q20Tg + MO1-atxn7 standard conditions Fig. 7 from Carrillo-Rosas et al., 2018
cranial nerve II axonal fasciculation disrupted, abnormal cu2Tg; jh1Tg; q20Tg + MO1-atxn7 standard conditions Fig. 7 from Carrillo-Rosas et al., 2018
Citations