Morpholino

MO3-egr1

ID

ZDB-MRPHLNO-130111-3

Name

MO3-egr1

Previous Names

None

Target

Sequence

5' - GGATTTAGTGCTTACCTCCAGCAAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-egr1

Expressed Gene	Anatomy	Figures
dlx2a	ceratobranchial cartilage neural crest pharyngeal arch 1 pharyngeal arch 2	Fig. 2 from Dalcq et al., 2012
edn1	head ventral region	Fig. 8 from Dalcq et al., 2012
fsta	brain head ventral region pharyngeal pouch	Fig. 7 , Fig. 8 from Dalcq et al., 2012
hand2	head ventral region	Fig. 8 from Dalcq et al., 2012
nkx2.3	pharyngeal pouch	Fig. 4 from Dalcq et al., 2012
runx2b	(not) ceratobranchial cartilage (not) ceratohyal cartilage cleithrum (not) ethmoid cartilage (not) hyosymplectic cartilage (not) pharyngeal arch 1	Fig. 2 from Dalcq et al., 2012
runx3	cleithrum pharyngeal pouch trigeminal ganglion	Fig. 5 from Dalcq et al., 2012
sox9a	ceratobranchial cartilage pharyngeal arch chondrocyte	Fig. 2 from Dalcq et al., 2012
sox9b	brain (not) pharyngeal pouch	Fig. 4 from Dalcq et al., 2012
tfap2a	neural crest	Fig. 2 from Dalcq et al., 2012

Phenotype

Phenotype resulting from MO3-egr1

Phenotype	Fish	Figures
ceratobranchial cartilage hypoplastic, abnormal	WT + MO3-egr1	Fig. 1 from Dalcq et al., 2012
ceratohyal cartilage malformed, abnormal	WT + MO3-egr1	Fig. 1 from Dalcq et al., 2012
hyosymplectic cartilage malformed, abnormal	WT + MO3-egr1	Fig. 1 from Dalcq et al., 2012
Meckel's cartilage hypoplastic, abnormal	WT + MO3-egr1	Fig. 1 from Dalcq et al., 2012
palatoquadrate cartilage hypoplastic, abnormal	WT + MO3-egr1	Fig. 1 from Dalcq et al., 2012
pharyngeal arch 3-7 aplastic, abnormal	WT + MO3-egr1	Fig. 1 from Dalcq et al., 2012

Phenotype of all Fish created by or utilizing MO3-egr1

Phenotype	Fish	Conditions	Figures
Meckel's cartilage hypoplastic, abnormal	WT + MO3-egr1	standard conditions	Fig. 1 from Dalcq et al., 2012
palatoquadrate cartilage hypoplastic, abnormal	WT + MO3-egr1	standard conditions	Fig. 1 from Dalcq et al., 2012
ceratobranchial cartilage hypoplastic, abnormal	WT + MO3-egr1	standard conditions	Fig. 1 from Dalcq et al., 2012
ceratohyal cartilage malformed, abnormal	WT + MO3-egr1	standard conditions	Fig. 1 from Dalcq et al., 2012
pharyngeal arch 3-7 aplastic, abnormal	WT + MO3-egr1	standard conditions	Fig. 1 from Dalcq et al., 2012
hyosymplectic cartilage malformed, abnormal	WT + MO3-egr1	standard conditions	Fig. 1 from Dalcq et al., 2012

Citations